Сбор от кашля: Чем нас лечат: грудные сборы. Помогают ли травки от кашля

By | 07.06.1979

Травяные сборы от кашля | Доктор МОМ®

Количество просмотров: 16 294Дата последнего обновления: 17.02.2022 г.

Содержание:
Состав травяных сборов
Показания для применения травяных сборов от кашля

На сегодняшний день сборы от кашля с лекарственными травами можно назватьодним из самых популярных альтернативных методов лечения заболеванийдыхательных путей. Это обусловлено малым количеством противопоказаний киспользованию таких средств (по сравнению с фармацевтическими cинтетическими препаратами), возможностью применять некоторые сборы  для облегчения симптомов как уребенка, так и взрослого человека, а также более мягким действием.

Состав травяных сборов:

Сбор трав от кашля может включать в себя самые разные лекарственные растения и ихэкстракты, разрешенные как ребенку, так и взрослому. В рецептуру сбора, какправило, входят растительные компоненты разного  спектрадействия.Противовоспалительное действие. Базилик священный, паслен индийский, девясил кистецветный, адатодавасика, солодка голая, куркума длинная, эмблика лекарственная, имбирь лекарственный.Антимикробное действие в сборах трав обеспечивает алоэ барбадосское, адатодавасика, эмбликалекарственная, эвкалипт.Отхаркивающее действие – заслуга паслена индийского, терминалиибелерика, девясила кистецветного, адатодывасика, солодки голой.Жаропонижающее действие оказывает паслен индийский, эмблика лекарственная.Как можно увидеть, многие растительные компоненты способны оказывать несколько действий. Именно это позволяет включать в сбор от кашля растительные экстракты или части растений, которые оказывают комплексное воздействие на организм ребенка или взрослого. Кроме того, перечисленные эффекты могут считаться основными для растений, но они не являются единственными. Например, куркума длинная – полезное средство для повышения аппетита и нормализации работы желудочно-кишечного тракта, что немаловажно для ребенка или взрослого, перенесшего какое-либо заболевание. Поэтому экстракт этого растения часто включают в сборы от кашля для детей – как в виде сиропов, так и в форме леденцов и пастилок. Ребенка проще убедить выпить ложку ароматного сиропа или пососать вкусный леденец, чем принять горькое лекарство – это еще одно преимущество лечения средствами растительного происхождения.В список действий, оказываемых перечисленными растениями, можно также включить очищающий и тонизирующий эффект, усиление иммунитета и повышение сопротивляемости организма, обезболивание. Более подробно о лекарственных травах, входящих в препараты серии Доктор МОМ®, Вы можете прочитать здесь.

Показания для применения травяных сборов от кашля

Очень часто заболевания, провоцирующие кашель, сопровождаются нарушениями носового дыхания, повышенной утомляемостью, интоксикацией, обусловленной присутствием инфекции и другими симптомами. При составлении композиции травяного сбора учитываются такие симптомы, и в состав включаются лечебные растения, содержащие экстракты, облегчающие дыхание и откашливание, повышающие тонус организма и помогающие вывести токсины. Тщательно подобранные компоненты – главное условие, при соблюдении которого сборы из трав оказывают комплексное и целительное действие.

Вам также может быть интересно:

Сбор трав № 6 При хроническом бронхите, астматическом бронхите, кашле Травы Кавказа, 225 г

Сбор трав № 6 При хроническом бронхите, астматическом бронхите, кашле способствует снятию воспаления, разжижает мокроту, очищает дыхательные пути. Отхаркивающее средство.

Уникальный по своему составу лекарственный Сбор № 6, завариваемый и принимаемый в виде горячего, ароматного травяного питья, излечит любые виды кашля и избавит Вас даже от застарелого хронического бронхита. Целебные травы, входящие в его состав, способны справиться и астматическим бронхитом, и с затянувшейся простудой.

Природным противовоспалительным эффектом, превосходящим многие химические препараты, обладают солодка, девясил и вероника, а эвкалипт, почки сосны и чабрец издавна славятся своим бактерицидным действием.

Настоящими специалистами по борьбе с бронхитами можно считать такие травы, как коровяк, мальва, мать-и-мачеха, липа, мох исландский, корень алтея и гринделия. Они обеспечат мягкое и эффективное разжижение и выведение скопившейся мокроты из бронхов.

Солодка голая и корень алтея эффективно справятся с кашлевым рефлексом, работая как кодеин натурального происхождения, а чабрец, душица и липа окажут общеукрепляющее и успокоительное воздействие на организм.

Простудный кашель, хронический или астматический бронхит легко, эффективно и вкусно способен излечить травяной Сбор № 6. Целебная сила российских трав заложена в природную формулу Вашего здоровья!

Состав: чабреца трава, душицы трава, мать-и-мачехи листья, эвкалипта листья, липы цветки, мох исландский, коровяка цветки, алтея корни, девясила корни, солодки корни, кипрея узколистного трава, лабазника вязолистного трава, фиалки трехцветной трава.

Страна производства: Кавказ.

Показания: хронический, обструктивный бронхит, астматический бронхит, кашель.

Способ приготовления и применения: 1 столовую ложку сбора залить 0,5 л кипятка, тепло укутать, 1 час настаивать, процедить. Пить теплым по 0,5 стакана за 30 минут до еды четыре раза в сутки, четвертый раз – перед сном.

Курс применения: 30 дней профилактический курс, 60 дней лечебный курс.

Противопоказания: индивидуальная непереносимость компонентов, беременность, лактация.

Совмещение: можно рекомендовать совмещение со сборами № 51 Витаминный и № 51-а Чаевой через час после еды в дозировке 1 ч.л. на стакан кипятка, пить 2 раза в день, № 63 для ингаляций. После приема курса сбора № 6 для укрепления и поддержки организма отдельно пройти курс № 42 или № 62.

Сезонность: для достижения лучшего результата прием сбора рекомендован в начале весны и осени, когда хронические заболевания имеют склонность к обострению.

Ком в горле – причины появления, при каких заболеваниях возникает, диагностика и способы лечения

ВАЖНО!


Информацию из данного раздела нельзя использовать для самодиагностики и самолечения. В случае боли или иного обострения заболевания диагностические исследования должен назначать только лечащий врач. Для постановки диагноза и правильного назначения лечения следует обращаться к Вашему лечащему врачу.


Ощущение кома в горле – не редкость. Многие испытывали это безболезненное, но некомфортное состояние хотя бы раз в жизни. В медицинской литературе оно обозначается как глоточный шар. В большинстве случаев этот симптом не связан с серьезными заболеваниями, однако точный ответ можно получить только после консультации со специалистом, ведь существует ряд болезней, которые могут сопровождаться ощущением инородного тела в горле.

Разновидности

Общепринятой классификации не существует. Все зависит от причины, вызвавшей данное состояние.

Возможные причины появления ощущения кома в горле


Пациентов с жалобой на ком в горле можно разделить на две группы: у одних данное состояние возникает вследствие психоневрологических расстройств, а у других причина кроется в соматических, то есть относящихся непосредственно к внутренним органам, заболеваниях.


Нередко ощущение кома в горле появляется у людей легко возбудимых, чутко реагирующих на стресс и эмоциональные потрясения. Ком в горле еще издавна описывался врачами как симптом невротического расстройства, чаще возникающего у молодых женщин. Однако в настоящее время это состояние с одинаковой частотой встречается у людей обоих полов.

Если ощущение кома в горле постоянно и сохраняется в течение нескольких недель, то в первую очередь необходимо исключить онкопатологию. Это может быть злокачественный или доброкачественный процесс в области гортани, пищевода или других органов шеи, вызывающий сдавление окружающих тканей. Особое внимание следует проявить при возникновении у пациента жалоб на боль в области шеи или при глотании, повышенную утомляемость, снижение аппетита и массы тела.

Инфекционно-воспалительные заболевания ЛОР-органов также могут стать причиной глоточного шара.

Очень часто появление ощущения кома в горле связано с заболеваниями желудочно-кишечного тракта.


Необходимо выяснить, отмечаются ли у пациента такие симптомы, как изжога, кашель, кислая отрыжка, боль в желудке и чувство тяжести после еды.


Ощущение инородного тела в горле может быть вызвано патологией щитовидной железы. Увеличение объема железы чаще связано с нехваткой йода в пище или с аутоиммунным поражением (аутоиммунным тиреоидитом).

Иногда причиной ощущения кома в горле становится уменьшение и даже полное прекращение слюноотделения.


Такое состояние может возникнуть у больных сахарным диабетом, у женщин в климактерическом периоде, при системных аутоиммунных заболеваниях.


Увеличение лифматических узлов в области шеи так же может привести к дискомфорту и ощущению комка в горле.

Затруднение при глотании иногда может возникать вследствие остеохондроза шейного отдела позвоночника. При этом человека могут беспокоить головная боль, головокружение, боль в шее, спине, скованность движений.

Не стоит забывать о возможной роли травматического воздействия на ткани. Эндоскопические исследования и даже прием грубой пищи могут способствовать появлению неприятных ощущений в горле.

Ощущением кома в горле в основном сопровождаются:

  1. Заболевания ЛОР-органов (ангина, тонзиллит, эпиглоттит, фарингит). 
  2. Заболевания щитовидной железы (эндемический зоб, диффузный токсический зоб, аутоиммунный тиреоидит). 
  3. Новообразования в области шеи. 
  4. Остеохондроз шейного отдела позвоночника. 
  5. Гастроэзофагеальная рефлюксная болезнь (ГЭРБ). 
  6. Дискинезия пищевода. 
  7. Гетеротопия слизистой желудка. 
  8. Заболевания эндокринной системы (сахарный диабет, гормональные нарушения). 
  9. Системные аутоиммунные заболевания (склеродермия, синдром Шегрена). 
  10. Психологические факторы, стресс. 

К каким врачам обращаться

При появлении жалоб на ком в горле целесообразно обратиться в первую очередь к
врачу-терапевту, который после осмотра сможет направить пациента к специалисту узкого профиля, таких как: 

Диагностика

Для уточнения диагноза врач может назначить следующие виды обследования:


  1. Гастроскопия (эзофагогастродуоденоскопия, ЭГДС) при подозрении на гастроэзофагеальную болезнь и дискинезию пищевода.  

  2. УЗИ щитовидной железы, анализ крови на гормоны щитовидной железы. 

Инструкция по сбору мокроты при туберкулезе (туберкулезе)

Этот информационный бюллетень содержит пошаговые инструкции по предоставлению образца
мокроты.

На этой странице:
Зачем нужен анализ мокроты?
Как собрать образец мокроты

Зачем нужен анализ мокроты?

Ваш врач хочет собрать немного мокроты («мокроты»)
что вы кашляете из легких. Лаборатория исследует мокроту
на возбудителей туберкулеза (ТБ).

Проверка мокроты — лучший способ узнать, есть ли у вас туберкулез.
Если вы уже принимаете противотуберкулезные препараты, проверка мокроты
лучший способ узнать, работает ли лекарство.

Чтобы убедиться, что тест точен, вы должны откашлять мокроту из глубины
ваши легкие. Мокрота из легких обычно густая и липкая. слюна
выходит из вашего рта и является водянистым и жидким. Не собирайте слюну.

Совет: если вы не можете откашлять мокроту,
попробуйте вдохнуть пар из горячего душа или кастрюлю с кипящей водой.

Как собрать образец мокроты

Ваш врач или медсестра дадут вам специальный пластиковый стаканчик для сбора
ваша мокрота. Внимательно выполните следующие действия:

  1. Чашка очень чистая. Не открывайте его, пока не
    готовы его использовать.
  2. Как только вы проснетесь утром (до того, как вы что-нибудь съедите или выпьете),
    почистить зубы и прополоскать рот водой. Не используйте жидкость для полоскания рта.
  3. Если возможно, выйдите на улицу или откройте окно перед сбором мокроты
    образец. Это помогает защитить других людей от микробов туберкулеза, когда вы кашляете.
  4. Сделайте очень глубокий вдох и задержите дыхание на 5 секунд. Медленно дышите
    вне. Сделайте еще один глубокий вдох и сильно покашляйте, пока не появится мокрота.
    вверх в рот.
  5. Сплюнуть мокроту в пластиковый стаканчик.
  6. Продолжайте делать это до тех пор, пока мокрота не достигнет отметки 5 мл (или более)
    на пластиковом стаканчике. Это примерно 1 чайная ложка мокроты.
  7. Плотно завинтите крышку на чашке, чтобы она не протекала.
  8. Напишите на стаканчике дату сбора мокроты.
  9. Поместите чашку в коробку или пакет, который вам дала медсестра.
  10. Отдайте чашу в вашу клинику или медсестре.Вы можете хранить чашку в
    холодильник на ночь при необходимости. Не кладите его в морозилку
    или оставить при комнатной температуре.

Методы получения образца мокроты

Метод

Описание

Недостаток

Образец спонтанной мокроты

Пациент отхаркивает мокроту в стерильный контейнер

• Недорогой

• Легко сделать

• Пациент может быть не в состоянии откашлять мокроту без посторонней помощи или вместо этого может срыгивать слюну

• Медицинский работник должен инструктировать и контролировать пациента при сборе мокроты

Индукция мокроты

Пациент вдыхает солевой туман, который может вызвать глубокий кашель

• Легко сделать

•Используется для получения мокроты при непродуктивном кашле с мокротой

• Образцы могут быть водянистыми и их можно спутать со слюной (должно быть помечено как «индуцированный образец»)

•Может вызвать бронхоспазм

Бронхоскопия

Бронхоскоп вводят через рот или нос непосредственно в пораженный участок легкого и удаляют мокроту или легочную ткань

Использование для получения мокроты при непродуктивном откашливании мокроты или подозрении на другие диагнозы

•Самая дорогая и инвазивная процедура

•Требуется специальное оборудование

• Должен выполняться врачом-специалистом в больнице или клинике

.

•Требуется анестезия

Промывание желудка

Трубка вводится через рот или нос пациента и вводится в желудок для получения образца желудочного секрета, содержащего мокроту, которая откашливается в горло, а затем проглатывается

• Должна быть проведена, как только больной проснется утром; пациенту может потребоваться остаться в больнице

• Может быть неудобно для пациента

Способность устройства собирать бактерии из аэрозолей от кашля, выделяемых взрослыми с муковисцидозом

Версия 1.F1000рез. 2016; 5: 1920.

, A, 1, 2 , 2 , 3, 4 , 3, 4 , 5 , 5 и 6

Дэвид Н. Ку

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc., Декейтер, Джорджия, 30030, США

Сара К. Ку

2 MD Innovate, Inc., Декейтер, Джорджия, 30030, США

Бет Хелфман

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Наэль А.

Маккарти

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Бернард Дж. Вольф

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Джонас М. Винчелл

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Ларри Дж.Андерсон

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

Дэвид Н. Ку, Наэль А. Маккарти, Бернард Дж. Вольф, Джонас М. Винчелл и Ларри Дж. Андерсон были научными консультантами. Бет Хелфман собирала данные, предоставляла и ухаживала за пациентами исследования. Сара К. Ку написала и отредактировала большую часть рукописи. Все авторы согласились с окончательным содержанием статьи.

Конкурирующие интересы: Д-р Дэвид Н. Ку, Сара К. Ку и д-р Ларри Дж. Андерсон являются соавторами патента PneumoniaCheck™, лицензированного MD Innovate, Inc. из Центров по контролю и профилактике заболеваний США и Джорджии. Корпорация технических исследований.

Эта статья находится в открытом доступе и распространяется в соответствии с лицензией Creative Commons Attribution, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

Эта статья была процитирована другими статьями в PMC.

Заявление о доступности данных

Данные, упомянутые в этой статье, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Аннотация

Исходная информация : Идентификация легочных патогенов и резких всплесков легочных показателей остается проблемой при лечении пациентов с кистозным фиброзом (МВ). Бактерии из глубоких отделов легких можно брать из аэрозолей, образующихся при кашле.

Методы : Новое устройство было использовано для сбора и измерения уровня бактерий в аэрозолях от кашля у пациентов с муковисцидозом. Образцы мокроты и полости рта также были собраны и измерены для сравнения. синегнойная палочка ,
Золотистый стафилококк ,
Klebsiella pneumoniae и
Streptococcus mitis были обнаружены в образцах с помощью молекулярных анализов полимеразной цепной реакции в реальном времени (RT-PCR).

Результаты : В исследовании приняли участие 20 взрослых пациентов с муковисцидозом и 10 здоровых людей из контрольной группы. Бактерии, связанные с CF (CFRB), были обнаружены в 13/20 (65%) образцах кашля по сравнению с 15/15 (100%) образцах мокроты. Комменсал
S. mitis присутствовал у 0/17 (0%, р=0.0002) образцы кашля и 13/14 (93%) образцов мокроты. В нормальных контрольных образцах в образцах от кашля не было собрано никаких бактерий, но 4/10 (40%) образцов из полости рта были положительными на CFRB.

Выводы : Неинвазивный сбор аэрозолей от кашля может обнаруживать патогены нижних дыхательных путей у пациентов с муковисцидозом с такой же специфичностью и чувствительностью, что и показатели, определяемые БАЛ, без контаминации пероральными CFRB или комменсальными бактериями.

Ключевые слова: Муковисцидоз, аэрозоли, сбор образцов, респираторные инфекции, этиология

Введение

Этиологию инфекций нижних дыхательных путей в легких трудно определить, отчасти потому, инфекция недоступна
1–
4
.Доступ к такому образцу был бы важным шагом вперед в мониторинге и лечении муковисцидоза (МВ), а также других инфекций нижних дыхательных путей, таких как пневмония, туберкулез, астма, рак легких и т. д. В настоящее время ротоглоточный (ОП) , мокрота и образцы бронхоальвеолярного лаважа (БАЛ) обычно используются для наблюдения за пациентами с муковисцидозом. Образцы OP могут подходить для обнаружения вирусов, но не идеальны для большинства бактериальных патогенов. Мокрота обычно собирается для мониторинга муковисцидоза, но часто содержит загрязнители и бактерии, связанные с муковисцидозом (CFRB) из верхних дыхательных путей.Трудности, с которыми сталкиваются некоторые пациенты при получении приемлемого образца мокроты, еще больше снижают ценность этих образцов, часто заставляя врача лечить пациента эмпирическим путем.
1–
4
. БАЛ дает образец из легких, но это инвазивная процедура, которую нельзя использовать в обычном порядке. Образцы БАЛ могут также собирать загрязняющие вещества из верхних дыхательных путей.
5–
7
.

Альтернативным источником образцов легких являются аэрозоли, образующиеся при кашле
8–
12
.Исследования показывают, что один кашель может генерировать до 66 000 выбрасываемых частиц.
10,
13
. Пациенты с инфекциями нижних дыхательных путей могут заражать других через респираторное распространение возбудителей в аэрозолях, образующихся при кашле или чихании. Кашель вызывает более высокую концентрацию патогенов из нижних отделов легких, чем обычный выдох или чихание.
8–
13
. Новое устройство для сбора образцов от кашля (PneumoniaCheck™,
) собирает аэрозоли из легких на фильтр с микропорами, сводя к минимуму загрязнение верхних дыхательных путей.Затем можно использовать микробиологические или молекулярные анализы для обнаружения патогенов, собранных на фильтре устройства.

Контейнер для хранения и транспортировки образцов PneumoniaCheck™.

В устройстве используется резервуар для отделения содержимого полости рта от аэрозолей глубоко в легких с использованием гидромеханики для разделения (
). Первоначальный объем воздуха, который поступает при выдохе или кашле, представляет собой загрязненный воздух из верхних дыхательных путей, также известный как анатомическое мертвое пространство. Когда пациент кашляет в аппарат, этот воздух из верхних дыхательных путей сначала попадает в резервуар (
).Выдыхаемый воздух сначала поступает в резервуар, так как он имеет наименьшее сопротивление по сравнению с фильтром на конце устройства. Этот резервуар имеет объем 250 мл, что примерно на 100 мл больше, чем объем анатомического мертвого пространства у среднего взрослого человека.
15 , что гарантирует полное отделение всех аэрозолей верхних дыхательных путей. Расширенный резервуар неэластичен, создавая противодавление, поэтому последующий выдыхаемый воздух принудительно проходит через микробный фильтр (
). Таким образом, на фильтр собирается только легочное аэрозольное содержимое, не загрязняющее верхние дыхательные пути.

Гидромеханическое разделение дыхательных путей PneumoniaCheck™.

(
a ) Загрязненные частицы верхних дыхательных путей изо рта сначала заполняют воздушный резервуар. (
b ) Затем незагрязненные частицы нижних дыхательных путей из легких улавливаются фильтром.

Предыдущее исследование показало, что фильтр устройства более чем на 99 % эффективен для сбора переносимых по воздуху бактерий (диаметром приблизительно 3,1 мкм) и вирусов (диаметром приблизительно 2,8 мкм).
16 .Отбор проб из контрольной группы здоровых людей показал нулевое скопление содержимого ротовой полости на фильтре, даже при наличии во рту до 15 мл жидкости (имитирующей мокроту). Было показано, что устройство PneumoniaCheck™ значительно отделяет газ в нижних дыхательных путях от газа в верхних дыхательных путях в зависимости от уровня кислорода и алкоголя (p<0,0001). 16 .

МВ — это генетическое заболевание, которое ежегодно поражает легкие примерно 28 000 детей и взрослых в США.
17 . Люди с муковисцидозом часто имеют хронические инфекции легких и нуждаются в регулярном наблюдении, чтобы гарантировать, что бактериальная колонизация не перерастет в инфекцию.
26, г.
27
.Мы использовали образцы мокроты и кашля, чтобы сравнить их способность улавливать, идентифицировать и количественно определять относительные уровни легочных бактерий у взрослых пациентов с муковисцидозом. Цель этого исследования — определить, может ли устройство от кашля улавливать легочные патогены взрослых пациентов с хронической легочной инфекцией, одновременно исключая оральные бактерии.

Материалы и методы

Субъекты

Пациенты с муковисцидозом (n=20) в возрасте старше 18 лет были набраны из клиники для взрослых Центра кистозного фиброза Эмори в Атланте, Джорджия.Институциональный наблюдательный совет Эмори ({“type”:”entrez-нуклеотид”,”attrs”:{“text”:”H08353″,”term_id”:”873175″,”term_text”:”H08353″}}H08353) одобрил исследование и участники предоставили письменное информированное согласие. Размер выборки был достаточно мощным, чтобы продемонстрировать статистическую значимость отбора проб нижних отделов легких без орального загрязнения. Тесты парных пропорций проводились с использованием точной формы теста Макнемара для сравнения наличия CFRB между двумя образцами (т.е. кашель и мокрота).Критерий знакового ранга Уилкоксона использовался для сравнения порога цикла (
С
T
) значения между различными методами выборки. То
С
T
Значение 60 использовалось в качестве верхнего предела обнаружения для всех анализов ПЦР для определения относительного количества бактерий в каждом образце.

Клинические измерения

Образцы мазков из горла и устройства от кашля были взяты у 10 здоровых некурящих субъектов для нормального контроля. Отдельно у 20 взрослых пациентов с муковисцидозом были взяты образцы мокроты и средства от кашля.Сбор образцов устройства для кашля предшествовал сбору образцов мокроты, чтобы помочь вызвать мокроту. Сбор образцов находился под наблюдением, и аварийное оборудование было легко доступно.
Streptococcus mitis — это комменсальная бактерия, которая обнаруживается во рту, но не в легких.
14 .
Streptococcus pneumoniae и
Staphylococcus aureus также часто обнаруживаются в ротовой полости.
3 .
синегнойная палочка ,
Staphylococcus aureus и
Klebsiella pneumoniae являются бактериями, родственными муковисцидозу (CFRB).
18–
20
.Образцы полости рта и кашля были проанализированы на наличие этих бактерий для определения уровня загрязнения полости рта.

Определение достаточного сбора аэрозолей

Система отбора проб аэрозолей от кашля Fennelly (CASS)
29, г.
30
и дистанционная установка Knibbs
13 продемонстрировали, что частицы кашля могут нести значительные концентрации бактерий от инфекций нижних дыхательных путей. В предыдущей статье об устройстве для сбора кашля описывается способность устройства выборочно брать пробы из нижних отделов легких, исключая загрязнения полости рта.
16 .Устройство для кашля, используемое в этом исследовании, представляет собой менее громоздкий вариант по сравнению с методами Феннелли и Ниббса для сбора образцов легких. Каждый пациент кашлянул в устройство 10 раз, чтобы обеспечить достаточный сбор аэрозоля.

Микробиология

Микробиологическое культивирование имеет ряд ограничений, которые снижают эффективность и действенность экспресс-диагностики
24 . Образцы из горла, мокроты и кашля были проанализированы с использованием методов молекулярной ПЦР. Все образцы были обработаны в безопасном шкафу BSL 2.Фильтр от кашля удаляли, помещали в стерильный морозильный флакон на 2 мл и хранили при -80°С. Респираторные выделения, захваченные фильтром, удаляли путем увлажнения фильтра 1 мл буфера для лизиса (буфер для лизиса MagNA Pure LC; Roche Applied Science, Индианаполис, Индиана), встряхивания, инкубации в течение 5 минут при комнатной температуре и сбора с помощью пипетки. Жидкость, оставшуюся в фильтре, собирали, помещая фильтр в стерильную микроцентрифужную пробирку Costar SpinX с фильтром 0,45 мкм (Corning Inc., Corning, NY), центрифугированием в течение 1 мин при 10 000 об/мин и выделением с помощью пипетки. Затем оставшуюся жидкость объединяли с исходной собранной жидкостью, а затем экстрагировали 400 мкл на приборе MagNA Pure Compact Instrument (Roche Applied Science) в соответствии с инструкциями производителя. Экстрагированную нуклеиновую кислоту элюировали в 100 мкл буфера для элюции и хранили при -80°C для тестирования количественной ПЦР.

Образец мокроты смешивали с 1 мл фосфатно-солевого буфера (PBS), гомогенизировали пипетированием и встряхиванием, смешивали с 12.5 мМ равных объемов свежеприготовленного дитиотреитола (DTT, формат No Weigh™, Fisher Scientific) и инкубировали при комнатной температуре в течение 30 минут с периодическим встряхиванием. Полученный раствор разделяли на аликвоты по 400 мкл и хранили при -80°С. Затем аликвоту обработанного образца объемом 400 мкл экстрагировали на приборе MagNA Pure Compact и хранили, как описано выше.

Экстрагированная нуклеиновая кислота была протестирована на
P. aeruginosa ,
S. aureus ,
К. pneumoniae и
С.mitis с помощью индивидуальных ПЦР в реальном времени. Последовательности праймеров и зондов для этих анализов были описаны ранее.
25 . То
Праймеры S. mitis : прямой TTTTGTCATCTAGCCTTGC; Обратный GCAGTCATATCATCACCTTC и зонд ACTTGGGCAATCCCGACAGATTCTAAC с 5′-репортером FAM и 3′-гасителем BHQ. Реакции ПЦР проводили с использованием 5 мкл выделенной из образцов нуклеиновой кислоты и 12,5 мкл PerfeCTa Multiplex qPCR SuperMix (каталожный номер

-200; Quanta BioSciences), 0.Конечные концентрации каждого праймера 5 мкМ, конечная концентрация зонда 0,1 мкМ и вода без нуклеаз (номер по каталогу P1193; Promega) до конечного реакционного объема 25 мкл. Реакции ПЦР в реальном времени проводили с использованием стандартной машины ABI 7500 (Life Technologies, Карлсбад, Калифорния) с активацией фермента при 95°C в течение 5 минут, с последующими 45 циклами при 95°C в течение 15 секунд и 60°C в течение 1 минуты. . Все образцы от пациентов с муковисцидозом анализировали в двух повторах для каждой мишени. То
С
T
Значения для отдельных анализов ПЦР использовались как показатель относительного количества бактерий в образце.

Результаты

Все испытуемые благополучно завершили сбор образцов. В качестве контроля использовали десять здоровых испытуемых. Образцы мокроты и кашля были успешно собраны у 20 взрослых пациентов с муковисцидозом, за исключением пяти пациентов, которые не смогли получить образец мокроты.

Нормальные контроли продемонстрировали высокую частоту ложноположительных результатов при пероральном отборе проб, как показано на рис.
. Бактерии были выделены из мазков из зева у 4/10 (40%) нормальных здоровых субъектов контрольной группы.
С.pneumoniae был положительным в 2/10 (20%) пероральных образцах и
S. aureus был положительным в 3/10 (30%) пероральных образцах, при этом у одного субъекта были обнаружены обе бактерии. Напротив, 0/10 (0%, p = 0,0313) образцов от кашля были положительными на наличие бактерий в контрольной группе. Рассчитанная доля истинных отрицательных результатов или специфичность для образцов мокроты составила 60% и 100% для образцов от кашля.

Таблица 1.

Обнаружение бактерий в образцах из горла и при кашле у нормальных здоровых людей.

5 2

5 отрицательный

5 3

5 4

5 6

5 7

5 8

5 отрицательный

5

5 отрицательный

5 отрицательный

5 10

Горло Кашель
1 S. aureus отрицательный
отрицательный
отрицательный отрицательный
4 S. aureus Отрицательный
5 S. aureus ,
S.pneumoniae
отрицательный
отрицательный отрицательный
отрицательный отрицательный
8 С. пневмонии
Отрицательный Отрицательный

Специфика в CF пациентам было похоже. Для пациентов с муковисцидозом
S. mitis был выделен из 13/14 (93%) образцов мокроты, но ни в одном из образцов кашля (0%, p = 0,0002). Образцы от кашля, собранные не
S. mitis . CFRB был собран в образцах обоих типов. P. aeruginosa был выделен из 13/15 (87%) образцов мокроты и 9/20 (45%) образцов кашля (р=0,0213).
S. aureus был выделен из 9/15 (60%) образцов мокроты и 3/20 (15%) образцов кашля.
K. pneumoniae был выделен из 2/15 (13%) образцов мокроты и 3/20 (15%) образцов кашля.

В совокупности образцы мокроты были положительными на CFRB в 15/15 (100%) образцах. Образцы кашля были положительными на CFRB в 13/20 (65%) образцах. Образцы мокроты содержали 93% оральных комменсалов.Образцы мокроты были положительными в отношении трех и более возбудителей в 2/15 (13%) образцов и положительных в отношении двух и более возбудителей в 7/15 (47%) образцов. Напротив, образцы от кашля не имели комменсалов и были положительными у 65% пациентов с муковисцидозом. Образцы кашля были положительными на два или более возбудителей в 2/20 (10%, p<0,05) образцах, и ни один образец кашля не был положительным на три или более возбудителей. Результаты этих идентификаций ПЦР в реальном времени перечислены в .

Таблица 2.

Обнаружение бактерий в образцах мокроты и кашля взрослых пациентов с муковисцидозом.

5

5
2+ возбудителя

Мокрота Кашель
n=15* %

С
Т


диапазон
n=20 % С
Т


диапазон
P. aeruginosa 13/15 87% 18–33 2/20 45% 33–42
С.золотистый 9/15 60% 24–38 3/20 15% 36–40
К.пневмония 2/15 13% 37–38 3/20 15% 39–43
CFRB всего 15/15 100 % 18–38 13/20 65 % 33–43
7/15 47% 18–38 2/20 10% 36–43
3+ возбудителя 2/15 13% 18–38 0/20 0% Н/Д
С. митис 13/14† 93% 24–41 0/17§ 0% Н/Д

С
T
значения обратно пропорциональны количеству бактерий в образце, т. е. малые значения указывают на большее количество колониеобразующих единиц (КОЕ). Для образцов CFRB,
P. aeruginosa С
T
значения варьировались от 18–33 в образцах мокроты и 33–42 в образцах кашля.
S. aureus C
T
значения варьировались от 24–38 в образцах мокроты и 36–40 в образцах кашля.Для обоих
P. aeruginosa и
S. aureus образцы кашля и мокроты значительно различались по
С
T
значений (p=0,0017 и 0,0092 соответственно).
К. пневмонии C
T
значения варьировались от 37–38 в образцах мокроты и 39–43 в образцах кашля. Таким образом
С
T
значения для образцов кашля были постоянно выше, чем для мокроты. Обратите внимание, что образцы кашлевого фильтра от нормальных контролей не обнаруживали патогенов вплоть до
С
T
значений 60.

Обсуждение

Общепризнанно, что для сбора патогенов нижних дыхательных путей необходим простой, безопасный, неинвазивный, не требующий особого ухода, недорогой, широко доступный пробоотборник.
34–
37
.

Сбор содержимого нижних отделов легких при кашле намного проще, чем сбор образцов БАЛ. Метод удобен для пациентов, которые уже склонны к кашлю и сообщают, что использование аппарата помогло очистить легкие. Образцы кашля могут служить неинвазивным, но специфическим образцом для наблюдения на дому с целью наблюдения за всплесками легочных патогенов у пациентов с муковисцидозом. Использование устройства для сбора аэрозолей от кашля потенциально может стать чистой альтернативой пероральным образцам для обнаружения патогенов нижних отделов легких.

Как известно, обычно используемые образцы мокроты или мазков из ОП показывают сильное загрязнение верхних дыхательных путей
3,
4
. Почти все образцы мокроты были положительными на оральные комменсалы.
S. mitis . Напротив, ни один из образцов кашля не был положительным на
S. mitis . Это различие в комменсалах
С.mitis между образцами мокроты и кашля подтверждает ненадежность и низкую специфичность мокроты.
3,
4
. Кроме того, не все пациенты могут получить адекватный образец мокроты. Обследование 12 субъектов с парной мокротой и
Результаты S. mitis , 8/12 (67%) образцов мокроты и кашля дали согласующиеся положительные результаты, хотя шесть из этих восьми были положительными на наличие дополнительных бактерий в мокроте. Эти шесть образцов мокроты с множественными бактериями, вероятно, указывают на ложноположительные результаты от перорального загрязнения, а не от коинфекции.

Количество конкордантных образцов мокроты и кашля (2/12, 17%) было небольшим. И наоборот, патоген, обнаруженный в образце кашля, отличался от наблюдаемого в образце мокроты. В 2/12 (17%) образцах мокроты не были идентифицированы бактерии, которые были идентифицированы в образцах кашля, что, возможно, отражает маскированные показания, связанные с комменсальным отвлечением. Различия демонстрируют, что устройство от кашля не просто собирает мокроту.

P. aeruginosa — наиболее распространенная бактерия, обнаруживаемая в легких взрослых пациентов с муковисцидозом.
19 , а также была самой распространенной бактерией, собранной в нашей когорте.13/20 (65%) образцов кашля были положительными на CFRB. Эта заболеваемость и распределение патогенов при муковисцидозе аналогичны 59% положительных результатов на CFRB в пробах БАЛ.
22, г.
23
. Предыдущие серии образцов БАЛ в аналогичных популяциях дали положительный CFRB 59–85%, что аналогично 65% положительности от устройства для кашля, иллюстрирующего сопоставимую чувствительность.
22, г.
23
.

Сбор выдыхаемых аэрозолей изучался несколькими предыдущими группами. Альтернативным устройством для сбора аэрозолей является RTube™; однако он сильно различается по дизайну и функциям
28 .Система RTube™ предназначена для сбора всего выдыхаемого воздуха, который конденсируется.
28 , в то время как PneumoniaCheck™ предназначен для сбора аэрозолей в легких размером с частицы и отделения содержимого рта
16 . Большая часть выдыхаемого газа выходит из конца RTtube™, так как предназначен только для сбора водяного конденсата. Конденсат выдыхаемого воздуха может быть полезным образцом для определения уровня pH, но, как правило, не считается надежным образцом для выявления инфекций нижних дыхательных путей.
34–
37
.

Уэйнрайт
и др. ., сообщили об обнаружении
P. aeruginosa в аэрозолях от кашля по культуре
12 . Они сообщили о 25 из 28 (89%) положительных результатов в смешанной популяции детей и взрослых с муковисцидозом с использованием системы отбора проб аэрозолей от кашля (CASS) в течение 5 минут с каждым субъектом.
12 . Аналогично, Ниббс
и др. сообщили, что 14 из 18 (78%) пациентов подверглись аэрозольной
P. aeruginosa , которые оставались жизнеспособными и предположительно трансмиссивными в течение 45 минут после кашля, взятого с помощью импактора Андерсона.
13 .Ниббс
и др. . использовали обычные микробиологические культуры для количественного определения колониеобразующих единиц. В обоих этих исследованиях использовался специально сконструированный пробоотборник аэрозолей, который является дорогим, громоздким и сложным для использования в клинических условиях. Для этих исследований пациенты кашляют в стандартный мундштук, а аэрозоли всасываются в импакторы с помощью вакуумных воздушных насосов. Система CASS не предназначена для рутинного использования в клинических условиях, а мундштук не предназначен для исключения содержимого полости рта. Эти конструкции отличаются от PneumoniaCheck™, который имеет мундштук, специально предназначенный для исключения загрязнения ротовой полости.
16 .Высокая заболеваемость
P. aeruginosa при использовании мундштука и трубки типа трубки может отражать некоторый сбор содержимого полости рта с помощью CASS.

ОТ-ПЦР можно использовать для количественного определения количества патогенов в образце. Чем больше материала собирается на фильтре, тем
С
T
количество отсчетов упадет подобно обратному значению КОЕ
32 . Следует отметить, что аэрозольный образец легкого должен иметь более высокую
С
T
значений по сравнению с жидкими образцами мокроты из-за отсутствия контаминации и небольшого физического объема аэрозолей. С
T
значения в образцах мокроты колебались от 19 до 38, а в образцах от кашля – от 33 до 43 (p<0,001, ). Тем не менее, С
T
значения во всех положительных образцах от кашля значительно ниже исходного уровня >60 для нормального контроля. В то время как
С
T
значения выше для образцов от кашля, уровень фонового шума первичного фильтра >60, что допускает пределы обнаружения методом ПЦР, который может быть более чувствительным к CFRB легких.

Таблица 3.


С
T
значения образцов мокроты и кашля, сгруппированные по возбудителям.

2

5 N / A

5 N / A

5 N / A

5 6 9 0023

7

70023

9005 N / A

N / A

5 –

5 10

5 N / A

5 38

5 –

5 29

5 –

Субъект P. aeruginosa S. aureus К. пневмонии С. mitis
# Мокрота Кашля Мокроты Кашля Мокроты Кашель Мокроты Кашель
1 22 33 41
N / A 42 N / A
3 32 32
4 21 41 36 24
5 N / A N / A N / A
18 41 32
N / A N / A
N / A 35 N / A N / A
9 N / A N / A N / A N / A N / A 43 31
19 38 40 37 37 N / A
11 19 42 27 N / A N / A
12 20 30
13 33 39 30 33
14 33 40 24 33
15 37 32
16 25 31
17 33 39 27
25
19 25 39 29 39 29
20 22 42 34 Н/Д

Можно использовать
С
T
значений для сравнения относительного количества патогенов, выделяемых при кашле у отдельного пациента, по сравнению с популяцией
32, г.
33
.Джонс-Лопес
и др. обнаружили, что как больные муковисцидозом, так и больные туберкулезом могут образовывать аэрозоли с жизнеспособными патогенами, но количество патогенов, вырабатываемых отдельными людьми, сильно различается.
31 . Пациенты с большим количеством
M. tuberculosis в аэрозолях от кашля с большей вероятностью передавались другим
30 . Те, которые производят большое количество патогенов при кашле, могут быть более эффективными переносчиками, например. «суперраспределители»
13, г.
30
. Количество патогенов в кашле может быть критическим показателем передачи инфекционных заболеваний, борьбы с эпидемиями и мониторинга колонизации.В Джонс-Лопес
и др. . исследование, количество аэрозольных
M.tuberculosis резко снизилась после трех недель лечения. Таким образом, образец кашля также можно использовать для мониторинга уровня резистентных бактерий, если они присутствуют.

В опубликованных руководствах для пациентов с муковисцидозом предлагается ежеквартально собирать образцы из дыхательных путей для мониторинга легочных инфекций
26, г.
27
. Образцы кашля могут быть более специфичным и чувствительным методом мониторинга колонизации и определения инфекционности.Дополнительные исследования могут дополнительно изучить это приложение путем сравнения
С
T
значений с симптомами. Если за пациентом с муковисцидозом регулярно наблюдают, используя образцы от кашля, внезапное снижение
С
T Значение
может указывать на изменение бремени патогенов
32, г.
33
. То
С
T
Величина содержания патогенов в аэрозолях от кашля может быть полезной в качестве меры для определения того, растет ли количество возбудителей в легких.

Это исследование имеет несколько ограничений.В наше исследование были включены только взрослые пациенты; таким образом, мы не можем комментировать образование аэрозоля при кашле у детей. В этом исследовании сообщается о 20 пациентах. В большинстве исследований, опубликованных в литературе, задействовано одинаковое количество субъектов, поскольку идентификация нижних дыхательных путей всегда была огромной проблемой.
12, г.
13
. Будущие исследования могут оценить преимущества необходимости большего количества кашля или кашля в течение определенного периода времени, например 5 минут, для установления
С
T
пороговые значения для этого нового метода сбора образцов.Молекулярные анализы RT-PCR, использованные в этом исследовании, доступны не во всех больницах, хотя несколько коммерческих лабораторий могут предоставлять услуги по клинической респираторной идентификации.

Заключение

Таким образом, мы показали, что новое устройство может собирать легочные патогены взрослых пациентов с муковисцидозом из аэрозолей от кашля с идентификацией с помощью молекулярного анализа. Устройство исключает загрязнения полости рта, показывая более высокую специфичность, чем образцы мокроты. Выявление возбудителей в нижних дыхательных путях, вероятно, сыграет важную роль в лечении пациентов.
24 .Данные этого исследования предлагают альтернативу сбору мокроты для идентификации возбудителей нижних дыхательных путей.

Согласие

Письменное информированное согласие было получено всеми участниками в соответствии с протоколом Институционального наблюдательного совета № 000-2492, утвержденным Технологическим институтом Джорджии, Университетом Эмори и Центрами США по контролю и профилактике заболеваний.

Доступность данных

Данные, на которые ссылается эта статья, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Примечания

[версия 1; рефери: одобрено 2]

Заявление о финансировании

При поддержке внутренних грантов Центров США по контролю и профилактике заболеваний и Университетской больницы Эмори.

Спонсоры не участвовали в разработке дизайна исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Каталожные номера

1.
Бернс МВт:
Преципитины к клебсиеллам и другим энтеробактериям в сыворотке крови больных хроническими респираторными заболеваниями. Ланцет.
1968; 1 (7539): 383–385.
10.1016/С0140-6736(68)-6
[PubMed] [CrossRef] [Google Scholar]2.
Годдард А.Ф., Штаудингер Б.Дж., Дауд С.Е. и др. :
Прямые пробы легких при муковисцидозе указывают на то, что анализы образцов верхних дыхательных путей на основе ДНК могут искажать микробиоту легких.
Proc Natl Acad Sci U S A.
2012;109(34):13769–13774.
10.1073/пнас.1107435109

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3.
Лентино-младший, Лакс Д.А.:
Неценность посева мокроты при лечении инфекций нижних дыхательных путей. J Clin Microbiol.
1987; 25(5):758–762.

[Бесплатная статья PMC] [PubMed] [Google Scholar]4.
Розенфельд М., Эмерсон Дж., Аккурсо Ф. и др. :
Диагностическая точность культур из ротоглотки у младенцев и детей раннего возраста с муковисцидозом.
Педиатр Пульмонол.
1999;28(5):321–328.
10.1002/(SICI)1099-0496(199911)28:5<321::AID-PPUL3>3.0.CO;2-V
[PubMed] [CrossRef] [Google Scholar]5.
Гилкрист Ф.Дж., Саламат С., Клейтон С. и др. :
Бронхоальвеолярный лаваж у детей с муковисцидозом: сколько долей следует брать?
Арч Ди Чайлд.
2011;96:215–217.
10.1136/доп.2009.177618
[PubMed] [CrossRef] [Google Scholar]6.
Уилнер Д., Хейнс М.Р., Фурлан М. и др. :
Пространственное распределение микробных сообществ в легком при муковисцидозе.
ИСМЕ Дж.
2012;6(2):471–474.
10.1038/исмей.2011.104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7.
Уимберли Н., Фалинг Л.Дж., Бартлетт Дж.Г.:
Метод фиброоптической бронхоскопии для получения незагрязненных выделений из нижних дыхательных путей для бактериального посева.
Am Rev Respir Dis.
1979;119(3):337–343.
[PubMed] [Google Scholar]8.
Коуч Р.Б., Кейт Т.Р., Дуглас Р.Г.-младший и др. :
Влияние пути прививки на экспериментальное респираторное вирусное заболевание у добровольцев и доказательства воздушно-капельной передачи.
Бактериол Ред.
1966; 30 (3): 517–529.

[Бесплатная статья PMC] [PubMed] [Google Scholar]9.
Коуч Р.Б., Кейт Т. Р., Героне П.Дж. и др. :
Появление болезни с помощью мелкодисперсного аэрозоля Коксаки А
21 .
Дж Клин Инвест.
1965; 44 (4): 535–542.10.1172/ДЖКИ105166

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10.
Gerone PJ, Couch RB, Keefer GV и др. :
Оценка экспериментальных и природных вирусных аэрозолей.
Бактериол Ред.
1966; 30 (3): 576–584.

[Бесплатная статья PMC] [PubMed] [Google Scholar]11.
Ли Н., Чан П.К., Хуэй Д.С. и др. :
Вирусная нагрузка и продолжительность выделения вируса у взрослых пациентов, госпитализированных с гриппом.
J Заразить Dis.
2009;200(4):492–500.
10.1086/600383
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12.Уэйнрайт К.Э., Франция М.В., О’Рурк П. и др. :
Аэрозоли, вызываемые кашлем
Pseudomonas aeruginosa и другие грамотрицательные бактерии от пациентов с муковисцидозом.
Грудная клетка.
2009;64(11):926–931.
10.1136/thx.2008.112466

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13.
Ниббс Л.Д., Джонсон Г.Р., Кидд Т.Дж. и др. :
Жизнеспособность
Pseudomonas aeruginosa в аэрозолях от кашля, выделяемых людьми с муковисцидозом.
Грудная клетка.
2014;69(8):740–745.10.1136/thoraxjnl-2014-205213

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14.
Лильемарк В.Ф., Гиббонс Р.Дж.:
Пропорциональное распределение и относительная адгезия стрептококковых клещей (
mitis ) на различных поверхностях ротовой полости человека.
Заразить иммунн.
1972; 6 (5): 852–859.

[Бесплатная статья PMC] [PubMed] [Google Scholar]15.
Hart MC, Orzalesi MM, Cook CD:
Связь между анатомическим мертвым пространством дыхательных путей, размерами тела и объемом легких.
J Appl Physiol.
1963; 18 (3): 519–522.Справочный источник
[Google Академия] 16.
Scholz TL, Midha PA, Anderson LJ, et al. :
PneumoniaCheck: устройство для отбора проб аэрозолей из нижних дыхательных путей.
J Med Devices.
2010;4(4):041005
10.1115/1.4002760
[Перекрестная ссылка] [Академия Google] 17.
Реестр пациентов Фонда кистозного фиброза: Ежегодный отчет о данных за 2013 г. для директоров Центра. Бетесда, Мэриленд. 2014 г. [Google Академия] 18.
Фернесс Дж. К., Хабеб А., Спенсер Д. А. и соавт. :
В редакцию: Бронхоальвеолярный лаваж (БАЛ) при педиатрическом муковисцидозе (МВ): его клиническое применение, модифицированное аудитом в региональном центре МВ. Педиатр Пульмонол.
2002;33(3):234.
10.1002/стр.10052
[PubMed] [CrossRef] [Google Scholar] 20.
Рэмси Б.В., Венц К.Р., Смит А.Л. и соавт. :
Прогностическая ценность культур ротоглотки для выявления бактерий нижних дыхательных путей у пациентов с муковисцидозом.
Am Rev Respir Dis.
1991;144(2):331–337.
10.1164/ajrccm/144.2.331
[PubMed] [CrossRef] [Google Scholar] 21.
Армстронг Д.С., Гримвуд К., Карлин Дж.Б. и др. :
Бронхоальвеолярный лаваж или посев из ротоглотки для выявления патогенов нижних дыхательных путей у младенцев с муковисцидозом. Педиатр Пульмонол.
1996;21(5):267–275.
10.1002/(SICI)1099-0496(199605)21:5<267::AID-PPUL1>3. 0.CO;2-K
[PubMed] [CrossRef] [Google Scholar] 22.
Harris JK, De Groote MA, Sagel SD, et al. :
Молекулярная идентификация бактерий в жидкости бронхоальвеолярного лаважа у детей с муковисцидозом.
Proc Natl Acad Sci U S A.
2007;104(51):20529–20533.
10.1073/пнас.0709804104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]23.
Zemanick ET, Wagner BD, Harris JK, et al.:
Легочные обострения при муковисцидозе с отрицательными бактериальными культурами.
Педиатр Пульмонол.
2010;45(6):569–577.
10.1002/стр.21221

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]24.
Oosterheert JJ, Bonten MJ, Buskens E, et al. :
Алгоритм определения экономии затрат на таргетную антимикробную терапию по результатам экспресс-диагностики.
J Clin Microbiol.
2003;41(10):4708–4713.
10.1128/JCM.41.10.4708-4713.2003

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25.Эмери С.Л., Эрдман Д.Д., Боуэн М.Д. и соавт. :
Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для коронавируса, связанного с SARS.
Emer Infect Dis.
2004;10(2):311–316.
10.3201/eid1002.030759

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]26.
Сайман Л., Сигел Дж.,
Фонд муковисцидоза:
Рекомендации по инфекционному контролю для пациентов с муковисцидозом: микробиология, важные патогены и методы инфекционного контроля для предотвращения передачи инфекции от пациента к пациенту. Infect Control Hosp Epidemiol.
2003; 24 (5 Дополнение): S6–52.
10.1086/503485
[PubMed] [CrossRef] [Google Scholar] 27.
Yankaskas JR, Marshall BC, Sufian B, et al. :
Уход за взрослыми при муковисцидозе: консенсусный отчет конференции.
Сундук.
2004; 125 (1 Приложение): 1С–39С.
10.1378/грудь.125.1_доп.1С
[PubMed] [CrossRef] [Google Scholar] 28.
Сойер О.У., Диздар Э.А., Кескин О. и соавт. :
Сравнение двух методов сбора конденсата выдыхаемого воздуха.
Аллергия.
2006;61(8):1016–1018.
10.1111/j.1398-9995.2006.01064.x
[PubMed] [CrossRef] [Google Scholar] 29.
Феннелли К.П., Мартини Дж.В., Фултон К. Е. и др. :
Аэрозоли, вызываемые кашлем
Mycobacterium tuberculosis : новый метод изучения инфекционности.
Am J Respir Crit Care Med.
2004;169(5):604–609.
10.1164/rccm.200308-1101OC
[PubMed] [CrossRef] [Google Scholar] 30.
Феннелли К.П., Джонс-Лопес Э.К., Аякака И. и др. :
Изменчивость инфекционных аэрозолей, образующихся при кашле у больных туберкулезом легких. Am J Respir Crit Care Med.
2012;186(5):450–457.
10.1164/rccm.201203-0444OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]31.
Джонс-Лопес Э.К., Намугга О., Мамбова Ф. и др. :
аэрозоли от кашля
Mycobacterium tuberculosis предсказывают новую инфекцию: исследование бытовых контактов.
Am J Respir Crit Care Med.
2013;187(9):1007–1015.
10.1164/rccm.201208-1422OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]32.
Мехта Т., МакГрат Э., Бхимредди С. и др.:
Обнаружение устойчивости к осельтамивиру во время лечения инфекции вируса гриппа h2N1 2009 у пациентов с ослабленным иммунитетом: полезность пороговых значений цикла качественной ПЦР с обратной транскриптазой в реальном времени.
J Clin Microbiol.
2010;48(11):4326–4328.
10.1128/JCM.01190-10

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]33.
Эспи М.Дж., Уль Дж.Р., Слоан Л.М. и др. :
ПЦР в реальном времени в клинической микробиологии: приложения для рутинных лабораторных испытаний.
Clin Microbiol, версия
2006;19(1):165–256.10.1128/CMR.19.1.165-256.2006

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]34.
Xu Z, Shen F, Li X и др. :
Молекулярный и микроскопический анализ бактерий и вирусов в выдыхаемом воздухе, собранном с помощью простого метода импакции и конденсации.
PLoS Один.
2012;7(7):e41137.
10.1371/journal.pone.0041137

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]35.
Хауспи Л., Де Костер С., Кейартс Э. и др. :
Отбор проб конденсата выдыхаемого воздуха не является новым методом обнаружения респираторных вирусов. Вирол Дж.
2011;8:98.
10.1186/1743-422Х-8-98

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]36.
Фабиан П., Макдевитт Дж. Дж., ДеХаан В. Х. и др. :
Вирус гриппа в выдыхаемом воздухе человека: обсервационное исследование.
PLoS Один.
2008;3(7):e2691.
10.1371/journal.pone.0002691

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]37.
Huynh KN, Oliver BG, Stelzer S, et al. :
Новый метод отбора проб и обнаружения аэрозолей респираторных вирусов в выдыхаемом воздухе.
Clin Infect Dis.
2008;46(1):93–95.
10.1086/523000
[PubMed] [CrossRef] [Google Scholar]

Способность устройства собирать бактерии из аэрозолей от кашля, выделяемых взрослыми с муковисцидозом

Версия 1. F1000Res. 2016; 5: 1920.

, A, 1, 2 , 2 , 3, 4 , 3, 4 , 5 , 5 и 6

Дэвид Н. Ку

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

Сара К.

Ку

2 MD Innovate, Inc., Декейтер, Джорджия, 30030, США

Бет Хелфман

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Наэль А. Маккарти

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Бернард Дж.Вольф

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Джонас М. Винчелл

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Ларри Дж. Андерсон

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

Дэвид Н. Ку, Наэль А. Маккарти, Бернард Дж. Вольф, Джонас М. Винчелл и Ларри Дж. Андерсон были научными консультантами. Бет Хелфман собирала данные, предоставляла и ухаживала за пациентами исследования. Сара К. Ку написала и отредактировала большую часть рукописи. Все авторы согласились с окончательным содержанием статьи.

Конкурирующие интересы: Д-р Дэвид Н. Ку, Сара К. Ку и д-р Ларри Дж. Андерсон являются соавторами патента PneumoniaCheck™, лицензированного MD Innovate, Inc. из Центров по контролю и профилактике заболеваний США и Джорджии. Корпорация технических исследований.

Эта статья находится в открытом доступе и распространяется в соответствии с лицензией Creative Commons Attribution, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

Эта статья была процитирована другими статьями в PMC.

Заявление о доступности данных

Данные, упомянутые в этой статье, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Аннотация

Исходная информация : Идентификация легочных патогенов и резких всплесков легочных показателей остается проблемой при лечении пациентов с кистозным фиброзом (МВ). Бактерии из глубоких отделов легких можно брать из аэрозолей, образующихся при кашле.

Методы : Новое устройство было использовано для сбора и измерения уровня бактерий в аэрозолях от кашля у пациентов с муковисцидозом. Образцы мокроты и полости рта также были собраны и измерены для сравнения. синегнойная палочка ,
Золотистый стафилококк ,
Klebsiella pneumoniae и
Streptococcus mitis были обнаружены в образцах с помощью молекулярных анализов полимеразной цепной реакции в реальном времени (RT-PCR).

Результаты : В исследовании приняли участие 20 взрослых пациентов с муковисцидозом и 10 здоровых людей из контрольной группы. Бактерии, связанные с CF (CFRB), были обнаружены в 13/20 (65%) образцах кашля по сравнению с 15/15 (100%) образцах мокроты. Комменсал
S. mitis присутствовал у 0/17 (0%, р=0.0002) образцы кашля и 13/14 (93%) образцов мокроты. В нормальных контрольных образцах в образцах от кашля не было собрано никаких бактерий, но 4/10 (40%) образцов из полости рта были положительными на CFRB.

Выводы : Неинвазивный сбор аэрозолей от кашля может обнаруживать патогены нижних дыхательных путей у пациентов с муковисцидозом с такой же специфичностью и чувствительностью, что и показатели, определяемые БАЛ, без контаминации пероральными CFRB или комменсальными бактериями.

Ключевые слова: Муковисцидоз, аэрозоли, сбор образцов, респираторные инфекции, этиология

Введение

Этиологию инфекций нижних дыхательных путей в легких трудно определить, отчасти потому, инфекция недоступна
1–
4
.Доступ к такому образцу был бы важным шагом вперед в мониторинге и лечении муковисцидоза (МВ), а также других инфекций нижних дыхательных путей, таких как пневмония, туберкулез, астма, рак легких и т. д. В настоящее время ротоглоточный (ОП) , мокрота и образцы бронхоальвеолярного лаважа (БАЛ) обычно используются для наблюдения за пациентами с муковисцидозом. Образцы OP могут подходить для обнаружения вирусов, но не идеальны для большинства бактериальных патогенов. Мокрота обычно собирается для мониторинга муковисцидоза, но часто содержит загрязнители и бактерии, связанные с муковисцидозом (CFRB) из верхних дыхательных путей.Трудности, с которыми сталкиваются некоторые пациенты при получении приемлемого образца мокроты, еще больше снижают ценность этих образцов, часто заставляя врача лечить пациента эмпирическим путем.
1–
4
. БАЛ дает образец из легких, но это инвазивная процедура, которую нельзя использовать в обычном порядке. Образцы БАЛ могут также собирать загрязняющие вещества из верхних дыхательных путей.
5–
7
.

Альтернативным источником образцов легких являются аэрозоли, образующиеся при кашле
8–
12
.Исследования показывают, что один кашель может генерировать до 66 000 выбрасываемых частиц.
10,
13
. Пациенты с инфекциями нижних дыхательных путей могут заражать других через респираторное распространение возбудителей в аэрозолях, образующихся при кашле или чихании. Кашель вызывает более высокую концентрацию патогенов из нижних отделов легких, чем обычный выдох или чихание.
8–
13
. Новое устройство для сбора образцов от кашля (PneumoniaCheck™,
) собирает аэрозоли из легких на фильтр с микропорами, сводя к минимуму загрязнение верхних дыхательных путей.Затем можно использовать микробиологические или молекулярные анализы для обнаружения патогенов, собранных на фильтре устройства.

Контейнер для хранения и транспортировки образцов PneumoniaCheck™.

В устройстве используется резервуар для отделения содержимого полости рта от аэрозолей глубоко в легких с использованием гидромеханики для разделения (
). Первоначальный объем воздуха, который поступает при выдохе или кашле, представляет собой загрязненный воздух из верхних дыхательных путей, также известный как анатомическое мертвое пространство. Когда пациент кашляет в аппарат, этот воздух из верхних дыхательных путей сначала попадает в резервуар (
).Выдыхаемый воздух сначала поступает в резервуар, так как он имеет наименьшее сопротивление по сравнению с фильтром на конце устройства. Этот резервуар имеет объем 250 мл, что примерно на 100 мл больше, чем объем анатомического мертвого пространства у среднего взрослого человека.
15 , что гарантирует полное отделение всех аэрозолей верхних дыхательных путей. Расширенный резервуар неэластичен, создавая противодавление, поэтому последующий выдыхаемый воздух принудительно проходит через микробный фильтр (
). Таким образом, на фильтр собирается только легочное аэрозольное содержимое, не загрязняющее верхние дыхательные пути.

Гидромеханическое разделение дыхательных путей PneumoniaCheck™.

(
a ) Загрязненные частицы верхних дыхательных путей изо рта сначала заполняют воздушный резервуар. (
b ) Затем незагрязненные частицы нижних дыхательных путей из легких улавливаются фильтром.

Предыдущее исследование показало, что фильтр устройства более чем на 99 % эффективен для сбора переносимых по воздуху бактерий (диаметром приблизительно 3,1 мкм) и вирусов (диаметром приблизительно 2,8 мкм).
16 .Отбор проб из контрольной группы здоровых людей показал нулевое скопление содержимого ротовой полости на фильтре, даже при наличии во рту до 15 мл жидкости (имитирующей мокроту). Было показано, что устройство PneumoniaCheck™ значительно отделяет газ в нижних дыхательных путях от газа в верхних дыхательных путях в зависимости от уровня кислорода и алкоголя (p<0,0001). 16 .

МВ — это генетическое заболевание, которое ежегодно поражает легкие примерно 28 000 детей и взрослых в США.
17 . Люди с муковисцидозом часто имеют хронические инфекции легких и нуждаются в регулярном наблюдении, чтобы гарантировать, что бактериальная колонизация не перерастет в инфекцию.
26, г.
27
.Мы использовали образцы мокроты и кашля, чтобы сравнить их способность улавливать, идентифицировать и количественно определять относительные уровни легочных бактерий у взрослых пациентов с муковисцидозом. Цель этого исследования — определить, может ли устройство от кашля улавливать легочные патогены взрослых пациентов с хронической легочной инфекцией, одновременно исключая оральные бактерии.

Материалы и методы

Субъекты

Пациенты с муковисцидозом (n=20) в возрасте старше 18 лет были набраны из клиники для взрослых Центра кистозного фиброза Эмори в Атланте, Джорджия.Институциональный наблюдательный совет Эмори ({“type”:”entrez-нуклеотид”,”attrs”:{“text”:”H08353″,”term_id”:”873175″,”term_text”:”H08353″}}H08353) одобрил исследование и участники предоставили письменное информированное согласие. Размер выборки был достаточно мощным, чтобы продемонстрировать статистическую значимость отбора проб нижних отделов легких без орального загрязнения. Тесты парных пропорций проводились с использованием точной формы теста Макнемара для сравнения наличия CFRB между двумя образцами (т.е. кашель и мокрота).Критерий знакового ранга Уилкоксона использовался для сравнения порога цикла (
С
T
) значения между различными методами выборки. То
С
T
Значение 60 использовалось в качестве верхнего предела обнаружения для всех анализов ПЦР для определения относительного количества бактерий в каждом образце.

Клинические измерения

Образцы мазков из горла и устройства от кашля были взяты у 10 здоровых некурящих субъектов для нормального контроля. Отдельно у 20 взрослых пациентов с муковисцидозом были взяты образцы мокроты и средства от кашля.Сбор образцов устройства для кашля предшествовал сбору образцов мокроты, чтобы помочь вызвать мокроту. Сбор образцов находился под наблюдением, и аварийное оборудование было легко доступно.
Streptococcus mitis — это комменсальная бактерия, которая обнаруживается во рту, но не в легких.
14 .
Streptococcus pneumoniae и
Staphylococcus aureus также часто обнаруживаются в ротовой полости.
3 .
синегнойная палочка ,
Staphylococcus aureus и
Klebsiella pneumoniae являются бактериями, родственными муковисцидозу (CFRB).
18–
20
.Образцы полости рта и кашля были проанализированы на наличие этих бактерий для определения уровня загрязнения полости рта.

Определение достаточного сбора аэрозолей

Система отбора проб аэрозолей от кашля Fennelly (CASS)
29, г.
30
и дистанционная установка Knibbs
13 продемонстрировали, что частицы кашля могут нести значительные концентрации бактерий от инфекций нижних дыхательных путей. В предыдущей статье об устройстве для сбора кашля описывается способность устройства выборочно брать пробы из нижних отделов легких, исключая загрязнения полости рта.
16 .Устройство для кашля, используемое в этом исследовании, представляет собой менее громоздкий вариант по сравнению с методами Феннелли и Ниббса для сбора образцов легких. Каждый пациент кашлянул в устройство 10 раз, чтобы обеспечить достаточный сбор аэрозоля.

Микробиология

Микробиологическое культивирование имеет ряд ограничений, которые снижают эффективность и действенность экспресс-диагностики
24 . Образцы из горла, мокроты и кашля были проанализированы с использованием методов молекулярной ПЦР. Все образцы были обработаны в безопасном шкафу BSL 2.Фильтр от кашля удаляли, помещали в стерильный морозильный флакон на 2 мл и хранили при -80°С. Респираторные выделения, захваченные фильтром, удаляли путем увлажнения фильтра 1 мл буфера для лизиса (буфер для лизиса MagNA Pure LC; Roche Applied Science, Индианаполис, Индиана), встряхивания, инкубации в течение 5 минут при комнатной температуре и сбора с помощью пипетки. Жидкость, оставшуюся в фильтре, собирали, помещая фильтр в стерильную микроцентрифужную пробирку Costar SpinX с фильтром 0,45 мкм (Corning Inc., Corning, NY), центрифугированием в течение 1 мин при 10 000 об/мин и выделением с помощью пипетки. Затем оставшуюся жидкость объединяли с исходной собранной жидкостью, а затем экстрагировали 400 мкл на приборе MagNA Pure Compact Instrument (Roche Applied Science) в соответствии с инструкциями производителя. Экстрагированную нуклеиновую кислоту элюировали в 100 мкл буфера для элюции и хранили при -80°C для тестирования количественной ПЦР.

Образец мокроты смешивали с 1 мл фосфатно-солевого буфера (PBS), гомогенизировали пипетированием и встряхиванием, смешивали с 12.5 мМ равных объемов свежеприготовленного дитиотреитола (DTT, формат No Weigh™, Fisher Scientific) и инкубировали при комнатной температуре в течение 30 минут с периодическим встряхиванием. Полученный раствор разделяли на аликвоты по 400 мкл и хранили при -80°С. Затем аликвоту обработанного образца объемом 400 мкл экстрагировали на приборе MagNA Pure Compact и хранили, как описано выше.

Экстрагированная нуклеиновая кислота была протестирована на
P. aeruginosa ,
S. aureus ,
К. pneumoniae и
С.mitis с помощью индивидуальных ПЦР в реальном времени. Последовательности праймеров и зондов для этих анализов были описаны ранее.
25 . То
Праймеры S. mitis : прямой TTTTGTCATCTAGCCTTGC; Обратный GCAGTCATATCATCACCTTC и зонд ACTTGGGCAATCCCGACAGATTCTAAC с 5′-репортером FAM и 3′-гасителем BHQ. Реакции ПЦР проводили с использованием 5 мкл выделенной из образцов нуклеиновой кислоты и 12,5 мкл PerfeCTa Multiplex qPCR SuperMix (каталожный номер

-200; Quanta BioSciences), 0.Конечные концентрации каждого праймера 5 мкМ, конечная концентрация зонда 0,1 мкМ и вода без нуклеаз (номер по каталогу P1193; Promega) до конечного реакционного объема 25 мкл. Реакции ПЦР в реальном времени проводили с использованием стандартной машины ABI 7500 (Life Technologies, Карлсбад, Калифорния) с активацией фермента при 95°C в течение 5 минут, с последующими 45 циклами при 95°C в течение 15 секунд и 60°C в течение 1 минуты. . Все образцы от пациентов с муковисцидозом анализировали в двух повторах для каждой мишени. То
С
T
Значения для отдельных анализов ПЦР использовались как показатель относительного количества бактерий в образце.

Результаты

Все испытуемые благополучно завершили сбор образцов. В качестве контроля использовали десять здоровых испытуемых. Образцы мокроты и кашля были успешно собраны у 20 взрослых пациентов с муковисцидозом, за исключением пяти пациентов, которые не смогли получить образец мокроты.

Нормальные контроли продемонстрировали высокую частоту ложноположительных результатов при пероральном отборе проб, как показано на рис.
. Бактерии были выделены из мазков из зева у 4/10 (40%) нормальных здоровых субъектов контрольной группы.
С.pneumoniae был положительным в 2/10 (20%) пероральных образцах и
S. aureus был положительным в 3/10 (30%) пероральных образцах, при этом у одного субъекта были обнаружены обе бактерии. Напротив, 0/10 (0%, p = 0,0313) образцов от кашля были положительными на наличие бактерий в контрольной группе. Рассчитанная доля истинных отрицательных результатов или специфичность для образцов мокроты составила 60% и 100% для образцов от кашля.

Таблица 1.

Обнаружение бактерий в образцах из горла и при кашле у нормальных здоровых людей.

5 2

5 отрицательный

5 3

5 4

5 6

5 7

5 8

5 отрицательный

5

5 отрицательный

5 отрицательный

5 10

Горло Кашель
1 S. aureus отрицательный
отрицательный
отрицательный отрицательный
4 S. aureus Отрицательный
5 S. aureus ,
S.pneumoniae
отрицательный
отрицательный отрицательный
отрицательный отрицательный
8 С. пневмонии
Отрицательный Отрицательный

Специфика в CF пациентам было похоже. Для пациентов с муковисцидозом
S. mitis был выделен из 13/14 (93%) образцов мокроты, но ни в одном из образцов кашля (0%, p = 0,0002). Образцы от кашля, собранные не
S. mitis . CFRB был собран в образцах обоих типов. P. aeruginosa был выделен из 13/15 (87%) образцов мокроты и 9/20 (45%) образцов кашля (р=0,0213).
S. aureus был выделен из 9/15 (60%) образцов мокроты и 3/20 (15%) образцов кашля.
K. pneumoniae был выделен из 2/15 (13%) образцов мокроты и 3/20 (15%) образцов кашля.

В совокупности образцы мокроты были положительными на CFRB в 15/15 (100%) образцах. Образцы кашля были положительными на CFRB в 13/20 (65%) образцах. Образцы мокроты содержали 93% оральных комменсалов.Образцы мокроты были положительными в отношении трех и более возбудителей в 2/15 (13%) образцов и положительных в отношении двух и более возбудителей в 7/15 (47%) образцов. Напротив, образцы от кашля не имели комменсалов и были положительными у 65% пациентов с муковисцидозом. Образцы кашля были положительными на два или более возбудителей в 2/20 (10%, p<0,05) образцах, и ни один образец кашля не был положительным на три или более возбудителей. Результаты этих идентификаций ПЦР в реальном времени перечислены в .

Таблица 2.

Обнаружение бактерий в образцах мокроты и кашля взрослых пациентов с муковисцидозом.

5

5
2+ возбудителя

Мокрота Кашель
n=15* %

С
Т


диапазон
n=20 % С
Т


диапазон
P. aeruginosa 13/15 87% 18–33 2/20 45% 33–42
С.золотистый 9/15 60% 24–38 3/20 15% 36–40
К.пневмония 2/15 13% 37–38 3/20 15% 39–43
CFRB всего 15/15 100 % 18–38 13/20 65 % 33–43
7/15 47% 18–38 2/20 10% 36–43
3+ возбудителя 2/15 13% 18–38 0/20 0% Н/Д
С. митис 13/14† 93% 24–41 0/17§ 0% Н/Д

С
T
значения обратно пропорциональны количеству бактерий в образце, т. е. малые значения указывают на большее количество колониеобразующих единиц (КОЕ). Для образцов CFRB,
P. aeruginosa С
T
значения варьировались от 18–33 в образцах мокроты и 33–42 в образцах кашля.
S. aureus C
T
значения варьировались от 24–38 в образцах мокроты и 36–40 в образцах кашля.Для обоих
P. aeruginosa и
S. aureus образцы кашля и мокроты значительно различались по
С
T
значений (p=0,0017 и 0,0092 соответственно).
К. пневмонии C
T
значения варьировались от 37–38 в образцах мокроты и 39–43 в образцах кашля. Таким образом
С
T
значения для образцов кашля были постоянно выше, чем для мокроты. Обратите внимание, что образцы кашлевого фильтра от нормальных контролей не обнаруживали патогенов вплоть до
С
T
значений 60.

Обсуждение

Общепризнанно, что для сбора патогенов нижних дыхательных путей необходим простой, безопасный, неинвазивный, не требующий особого ухода, недорогой, широко доступный пробоотборник.
34–
37
.

Сбор содержимого нижних отделов легких при кашле намного проще, чем сбор образцов БАЛ. Метод удобен для пациентов, которые уже склонны к кашлю и сообщают, что использование аппарата помогло очистить легкие. Образцы кашля могут служить неинвазивным, но специфическим образцом для наблюдения на дому с целью наблюдения за всплесками легочных патогенов у пациентов с муковисцидозом. Использование устройства для сбора аэрозолей от кашля потенциально может стать чистой альтернативой пероральным образцам для обнаружения патогенов нижних отделов легких.

Как известно, обычно используемые образцы мокроты или мазков из ОП показывают сильное загрязнение верхних дыхательных путей
3,
4
. Почти все образцы мокроты были положительными на оральные комменсалы.
S. mitis . Напротив, ни один из образцов кашля не был положительным на
S. mitis . Это различие в комменсалах
С.mitis между образцами мокроты и кашля подтверждает ненадежность и низкую специфичность мокроты.
3,
4
. Кроме того, не все пациенты могут получить адекватный образец мокроты. Обследование 12 субъектов с парной мокротой и
Результаты S. mitis , 8/12 (67%) образцов мокроты и кашля дали согласующиеся положительные результаты, хотя шесть из этих восьми были положительными на наличие дополнительных бактерий в мокроте. Эти шесть образцов мокроты с множественными бактериями, вероятно, указывают на ложноположительные результаты от перорального загрязнения, а не от коинфекции.

Количество конкордантных образцов мокроты и кашля (2/12, 17%) было небольшим. И наоборот, патоген, обнаруженный в образце кашля, отличался от наблюдаемого в образце мокроты. В 2/12 (17%) образцах мокроты не были идентифицированы бактерии, которые были идентифицированы в образцах кашля, что, возможно, отражает маскированные показания, связанные с комменсальным отвлечением. Различия демонстрируют, что устройство от кашля не просто собирает мокроту.

P. aeruginosa — наиболее распространенная бактерия, обнаруживаемая в легких взрослых пациентов с муковисцидозом.
19 , а также была самой распространенной бактерией, собранной в нашей когорте.13/20 (65%) образцов кашля были положительными на CFRB. Эта заболеваемость и распределение патогенов при муковисцидозе аналогичны 59% положительных результатов на CFRB в пробах БАЛ.
22, г.
23
. Предыдущие серии образцов БАЛ в аналогичных популяциях дали положительный CFRB 59–85%, что аналогично 65% положительности от устройства для кашля, иллюстрирующего сопоставимую чувствительность.
22, г.
23
.

Сбор выдыхаемых аэрозолей изучался несколькими предыдущими группами. Альтернативным устройством для сбора аэрозолей является RTube™; однако он сильно различается по дизайну и функциям
28 .Система RTube™ предназначена для сбора всего выдыхаемого воздуха, который конденсируется.
28 , в то время как PneumoniaCheck™ предназначен для сбора аэрозолей в легких размером с частицы и отделения содержимого рта
16 . Большая часть выдыхаемого газа выходит из конца RTtube™, так как предназначен только для сбора водяного конденсата. Конденсат выдыхаемого воздуха может быть полезным образцом для определения уровня pH, но, как правило, не считается надежным образцом для выявления инфекций нижних дыхательных путей.
34–
37
.

Уэйнрайт
и др. ., сообщили об обнаружении
P. aeruginosa в аэрозолях от кашля по культуре
12 . Они сообщили о 25 из 28 (89%) положительных результатов в смешанной популяции детей и взрослых с муковисцидозом с использованием системы отбора проб аэрозолей от кашля (CASS) в течение 5 минут с каждым субъектом.
12 . Аналогично, Ниббс
и др. сообщили, что 14 из 18 (78%) пациентов подверглись аэрозольной
P. aeruginosa , которые оставались жизнеспособными и предположительно трансмиссивными в течение 45 минут после кашля, взятого с помощью импактора Андерсона.
13 .Ниббс
и др. . использовали обычные микробиологические культуры для количественного определения колониеобразующих единиц. В обоих этих исследованиях использовался специально сконструированный пробоотборник аэрозолей, который является дорогим, громоздким и сложным для использования в клинических условиях. Для этих исследований пациенты кашляют в стандартный мундштук, а аэрозоли всасываются в импакторы с помощью вакуумных воздушных насосов. Система CASS не предназначена для рутинного использования в клинических условиях, а мундштук не предназначен для исключения содержимого полости рта. Эти конструкции отличаются от PneumoniaCheck™, который имеет мундштук, специально предназначенный для исключения загрязнения ротовой полости.
16 .Высокая заболеваемость
P. aeruginosa при использовании мундштука и трубки типа трубки может отражать некоторый сбор содержимого полости рта с помощью CASS.

ОТ-ПЦР можно использовать для количественного определения количества патогенов в образце. Чем больше материала собирается на фильтре, тем
С
T
количество отсчетов упадет подобно обратному значению КОЕ
32 . Следует отметить, что аэрозольный образец легкого должен иметь более высокую
С
T
значений по сравнению с жидкими образцами мокроты из-за отсутствия контаминации и небольшого физического объема аэрозолей. С
T
значения в образцах мокроты колебались от 19 до 38, а в образцах от кашля – от 33 до 43 (p<0,001, ). Тем не менее, С
T
значения во всех положительных образцах от кашля значительно ниже исходного уровня >60 для нормального контроля. В то время как
С
T
значения выше для образцов от кашля, уровень фонового шума первичного фильтра >60, что допускает пределы обнаружения методом ПЦР, который может быть более чувствительным к CFRB легких.

Таблица 3.


С
T
значения образцов мокроты и кашля, сгруппированные по возбудителям.

2

5 N / A

5 N / A

5 N / A

5 6 9 0023

7

70023

9005 N / A

N / A

5 –

5 10

5 N / A

5 38

5 –

5 29

5 –

Субъект P. aeruginosa S. aureus К. пневмонии С. mitis
# Мокрота Кашля Мокроты Кашля Мокроты Кашель Мокроты Кашель
1 22 33 41
N / A 42 N / A
3 32 32
4 21 41 36 24
5 N / A N / A N / A
18 41 32
N / A N / A
N / A 35 N / A N / A
9 N / A N / A N / A N / A N / A 43 31
19 38 40 37 37 N / A
11 19 42 27 N / A N / A
12 20 30
13 33 39 30 33
14 33 40 24 33
15 37 32
16 25 31
17 33 39 27
25
19 25 39 29 39 29
20 22 42 34 Н/Д

Можно использовать
С
T
значений для сравнения относительного количества патогенов, выделяемых при кашле у отдельного пациента, по сравнению с популяцией
32, г.
33
.Джонс-Лопес
и др. обнаружили, что как больные муковисцидозом, так и больные туберкулезом могут образовывать аэрозоли с жизнеспособными патогенами, но количество патогенов, вырабатываемых отдельными людьми, сильно различается.
31 . Пациенты с большим количеством
M. tuberculosis в аэрозолях от кашля с большей вероятностью передавались другим
30 . Те, которые производят большое количество патогенов при кашле, могут быть более эффективными переносчиками, например. «суперраспределители»
13, г.
30
. Количество патогенов в кашле может быть критическим показателем передачи инфекционных заболеваний, борьбы с эпидемиями и мониторинга колонизации.В Джонс-Лопес
и др. . исследование, количество аэрозольных
M.tuberculosis резко снизилась после трех недель лечения. Таким образом, образец кашля также можно использовать для мониторинга уровня резистентных бактерий, если они присутствуют.

В опубликованных руководствах для пациентов с муковисцидозом предлагается ежеквартально собирать образцы из дыхательных путей для мониторинга легочных инфекций
26, г.
27
. Образцы кашля могут быть более специфичным и чувствительным методом мониторинга колонизации и определения инфекционности.Дополнительные исследования могут дополнительно изучить это приложение путем сравнения
С
T
значений с симптомами. Если за пациентом с муковисцидозом регулярно наблюдают, используя образцы от кашля, внезапное снижение
С
T Значение
может указывать на изменение бремени патогенов
32, г.
33
. То
С
T
Величина содержания патогенов в аэрозолях от кашля может быть полезной в качестве меры для определения того, растет ли количество возбудителей в легких.

Это исследование имеет несколько ограничений.В наше исследование были включены только взрослые пациенты; таким образом, мы не можем комментировать образование аэрозоля при кашле у детей. В этом исследовании сообщается о 20 пациентах. В большинстве исследований, опубликованных в литературе, задействовано одинаковое количество субъектов, поскольку идентификация нижних дыхательных путей всегда была огромной проблемой.
12, г.
13
. Будущие исследования могут оценить преимущества необходимости большего количества кашля или кашля в течение определенного периода времени, например 5 минут, для установления
С
T
пороговые значения для этого нового метода сбора образцов.Молекулярные анализы RT-PCR, использованные в этом исследовании, доступны не во всех больницах, хотя несколько коммерческих лабораторий могут предоставлять услуги по клинической респираторной идентификации.

Заключение

Таким образом, мы показали, что новое устройство может собирать легочные патогены взрослых пациентов с муковисцидозом из аэрозолей от кашля с идентификацией с помощью молекулярного анализа. Устройство исключает загрязнения полости рта, показывая более высокую специфичность, чем образцы мокроты. Выявление возбудителей в нижних дыхательных путях, вероятно, сыграет важную роль в лечении пациентов.
24 .Данные этого исследования предлагают альтернативу сбору мокроты для идентификации возбудителей нижних дыхательных путей.

Согласие

Письменное информированное согласие было получено всеми участниками в соответствии с протоколом Институционального наблюдательного совета № 000-2492, утвержденным Технологическим институтом Джорджии, Университетом Эмори и Центрами США по контролю и профилактике заболеваний.

Доступность данных

Данные, на которые ссылается эта статья, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Примечания

[версия 1; рефери: одобрено 2]

Заявление о финансировании

При поддержке внутренних грантов Центров США по контролю и профилактике заболеваний и Университетской больницы Эмори.

Спонсоры не участвовали в разработке дизайна исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Каталожные номера

1.
Бернс МВт:
Преципитины к клебсиеллам и другим энтеробактериям в сыворотке крови больных хроническими респираторными заболеваниями. Ланцет.
1968; 1 (7539): 383–385.
10.1016/С0140-6736(68)-6
[PubMed] [CrossRef] [Google Scholar]2.
Годдард А.Ф., Штаудингер Б.Дж., Дауд С.Е. и др. :
Прямые пробы легких при муковисцидозе указывают на то, что анализы образцов верхних дыхательных путей на основе ДНК могут искажать микробиоту легких.
Proc Natl Acad Sci U S A.
2012;109(34):13769–13774.
10.1073/пнас.1107435109

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3.
Лентино-младший, Лакс Д.А.:
Неценность посева мокроты при лечении инфекций нижних дыхательных путей. J Clin Microbiol.
1987; 25(5):758–762.

[Бесплатная статья PMC] [PubMed] [Google Scholar]4.
Розенфельд М., Эмерсон Дж., Аккурсо Ф. и др. :
Диагностическая точность культур из ротоглотки у младенцев и детей раннего возраста с муковисцидозом.
Педиатр Пульмонол.
1999;28(5):321–328.
10.1002/(SICI)1099-0496(199911)28:5<321::AID-PPUL3>3.0.CO;2-V
[PubMed] [CrossRef] [Google Scholar]5.
Гилкрист Ф.Дж., Саламат С., Клейтон С. и др. :
Бронхоальвеолярный лаваж у детей с муковисцидозом: сколько долей следует брать?
Арч Ди Чайлд.
2011;96:215–217.
10.1136/доп.2009.177618
[PubMed] [CrossRef] [Google Scholar]6.
Уилнер Д., Хейнс М.Р., Фурлан М. и др. :
Пространственное распределение микробных сообществ в легком при муковисцидозе.
ИСМЕ Дж.
2012;6(2):471–474.
10.1038/исмей.2011.104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7.
Уимберли Н., Фалинг Л.Дж., Бартлетт Дж.Г.:
Метод фиброоптической бронхоскопии для получения незагрязненных выделений из нижних дыхательных путей для бактериального посева.
Am Rev Respir Dis.
1979;119(3):337–343.
[PubMed] [Google Scholar]8.
Коуч Р.Б., Кейт Т.Р., Дуглас Р.Г.-младший и др. :
Влияние пути прививки на экспериментальное респираторное вирусное заболевание у добровольцев и доказательства воздушно-капельной передачи.
Бактериол Ред.
1966; 30 (3): 517–529.

[Бесплатная статья PMC] [PubMed] [Google Scholar]9.
Коуч Р.Б., Кейт Т. Р., Героне П.Дж. и др. :
Появление болезни с помощью мелкодисперсного аэрозоля Коксаки А
21 .
Дж Клин Инвест.
1965; 44 (4): 535–542.10.1172/ДЖКИ105166

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10.
Gerone PJ, Couch RB, Keefer GV и др. :
Оценка экспериментальных и природных вирусных аэрозолей.
Бактериол Ред.
1966; 30 (3): 576–584.

[Бесплатная статья PMC] [PubMed] [Google Scholar]11.
Ли Н., Чан П.К., Хуэй Д.С. и др. :
Вирусная нагрузка и продолжительность выделения вируса у взрослых пациентов, госпитализированных с гриппом.
J Заразить Dis.
2009;200(4):492–500.
10.1086/600383
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12.Уэйнрайт К.Э., Франция М.В., О’Рурк П. и др. :
Аэрозоли, вызываемые кашлем
Pseudomonas aeruginosa и другие грамотрицательные бактерии от пациентов с муковисцидозом.
Грудная клетка.
2009;64(11):926–931.
10.1136/thx.2008.112466

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13.
Ниббс Л.Д., Джонсон Г.Р., Кидд Т.Дж. и др. :
Жизнеспособность
Pseudomonas aeruginosa в аэрозолях от кашля, выделяемых людьми с муковисцидозом.
Грудная клетка.
2014;69(8):740–745.10.1136/thoraxjnl-2014-205213

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14.
Лильемарк В.Ф., Гиббонс Р.Дж.:
Пропорциональное распределение и относительная адгезия стрептококковых клещей (
mitis ) на различных поверхностях ротовой полости человека.
Заразить иммунн.
1972; 6 (5): 852–859.

[Бесплатная статья PMC] [PubMed] [Google Scholar]15.
Hart MC, Orzalesi MM, Cook CD:
Связь между анатомическим мертвым пространством дыхательных путей, размерами тела и объемом легких.
J Appl Physiol.
1963; 18 (3): 519–522.Справочный источник
[Google Академия] 16.
Scholz TL, Midha PA, Anderson LJ, et al. :
PneumoniaCheck: устройство для отбора проб аэрозолей из нижних дыхательных путей.
J Med Devices.
2010;4(4):041005
10.1115/1.4002760
[Перекрестная ссылка] [Академия Google] 17.
Реестр пациентов Фонда кистозного фиброза: Ежегодный отчет о данных за 2013 г. для директоров Центра. Бетесда, Мэриленд. 2014 г. [Google Академия] 18.
Фернесс Дж. К., Хабеб А., Спенсер Д. А. и соавт. :
В редакцию: Бронхоальвеолярный лаваж (БАЛ) при педиатрическом муковисцидозе (МВ): его клиническое применение, модифицированное аудитом в региональном центре МВ. Педиатр Пульмонол.
2002;33(3):234.
10.1002/стр.10052
[PubMed] [CrossRef] [Google Scholar] 20.
Рэмси Б.В., Венц К.Р., Смит А.Л. и соавт. :
Прогностическая ценность культур ротоглотки для выявления бактерий нижних дыхательных путей у пациентов с муковисцидозом.
Am Rev Respir Dis.
1991;144(2):331–337.
10.1164/ajrccm/144.2.331
[PubMed] [CrossRef] [Google Scholar] 21.
Армстронг Д.С., Гримвуд К., Карлин Дж.Б. и др. :
Бронхоальвеолярный лаваж или посев из ротоглотки для выявления патогенов нижних дыхательных путей у младенцев с муковисцидозом. Педиатр Пульмонол.
1996;21(5):267–275.
10.1002/(SICI)1099-0496(199605)21:5<267::AID-PPUL1>3. 0.CO;2-K
[PubMed] [CrossRef] [Google Scholar] 22.
Harris JK, De Groote MA, Sagel SD, et al. :
Молекулярная идентификация бактерий в жидкости бронхоальвеолярного лаважа у детей с муковисцидозом.
Proc Natl Acad Sci U S A.
2007;104(51):20529–20533.
10.1073/пнас.0709804104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]23.
Zemanick ET, Wagner BD, Harris JK, et al.:
Легочные обострения при муковисцидозе с отрицательными бактериальными культурами.
Педиатр Пульмонол.
2010;45(6):569–577.
10.1002/стр.21221

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]24.
Oosterheert JJ, Bonten MJ, Buskens E, et al. :
Алгоритм определения экономии затрат на таргетную антимикробную терапию по результатам экспресс-диагностики.
J Clin Microbiol.
2003;41(10):4708–4713.
10.1128/JCM.41.10.4708-4713.2003

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25.Эмери С.Л., Эрдман Д.Д., Боуэн М.Д. и соавт. :
Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для коронавируса, связанного с SARS.
Emer Infect Dis.
2004;10(2):311–316.
10.3201/eid1002.030759

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]26.
Сайман Л., Сигел Дж.,
Фонд муковисцидоза:
Рекомендации по инфекционному контролю для пациентов с муковисцидозом: микробиология, важные патогены и методы инфекционного контроля для предотвращения передачи инфекции от пациента к пациенту. Infect Control Hosp Epidemiol.
2003; 24 (5 Дополнение): S6–52.
10.1086/503485
[PubMed] [CrossRef] [Google Scholar] 27.
Yankaskas JR, Marshall BC, Sufian B, et al. :
Уход за взрослыми при муковисцидозе: консенсусный отчет конференции.
Сундук.
2004; 125 (1 Приложение): 1С–39С.
10.1378/грудь.125.1_доп.1С
[PubMed] [CrossRef] [Google Scholar] 28.
Сойер О.У., Диздар Э.А., Кескин О. и соавт. :
Сравнение двух методов сбора конденсата выдыхаемого воздуха.
Аллергия.
2006;61(8):1016–1018.
10.1111/j.1398-9995.2006.01064.x
[PubMed] [CrossRef] [Google Scholar] 29.
Феннелли К.П., Мартини Дж.В., Фултон К. Е. и др. :
Аэрозоли, вызываемые кашлем
Mycobacterium tuberculosis : новый метод изучения инфекционности.
Am J Respir Crit Care Med.
2004;169(5):604–609.
10.1164/rccm.200308-1101OC
[PubMed] [CrossRef] [Google Scholar] 30.
Феннелли К.П., Джонс-Лопес Э.К., Аякака И. и др. :
Изменчивость инфекционных аэрозолей, образующихся при кашле у больных туберкулезом легких. Am J Respir Crit Care Med.
2012;186(5):450–457.
10.1164/rccm.201203-0444OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]31.
Джонс-Лопес Э.К., Намугга О., Мамбова Ф. и др. :
аэрозоли от кашля
Mycobacterium tuberculosis предсказывают новую инфекцию: исследование бытовых контактов.
Am J Respir Crit Care Med.
2013;187(9):1007–1015.
10.1164/rccm.201208-1422OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]32.
Мехта Т., МакГрат Э., Бхимредди С. и др.:
Обнаружение устойчивости к осельтамивиру во время лечения инфекции вируса гриппа h2N1 2009 у пациентов с ослабленным иммунитетом: полезность пороговых значений цикла качественной ПЦР с обратной транскриптазой в реальном времени.
J Clin Microbiol.
2010;48(11):4326–4328.
10.1128/JCM.01190-10

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]33.
Эспи М.Дж., Уль Дж.Р., Слоан Л.М. и др. :
ПЦР в реальном времени в клинической микробиологии: приложения для рутинных лабораторных испытаний.
Clin Microbiol, версия
2006;19(1):165–256.10.1128/CMR.19.1.165-256.2006

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]34.
Xu Z, Shen F, Li X и др. :
Молекулярный и микроскопический анализ бактерий и вирусов в выдыхаемом воздухе, собранном с помощью простого метода импакции и конденсации.
PLoS Один.
2012;7(7):e41137.
10.1371/journal.pone.0041137

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]35.
Хауспи Л., Де Костер С., Кейартс Э. и др. :
Отбор проб конденсата выдыхаемого воздуха не является новым методом обнаружения респираторных вирусов. Вирол Дж.
2011;8:98.
10.1186/1743-422Х-8-98

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]36.
Фабиан П., Макдевитт Дж. Дж., ДеХаан В. Х. и др. :
Вирус гриппа в выдыхаемом воздухе человека: обсервационное исследование.
PLoS Один.
2008;3(7):e2691.
10.1371/journal.pone.0002691

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]37.
Huynh KN, Oliver BG, Stelzer S, et al. :
Новый метод отбора проб и обнаружения аэрозолей респираторных вирусов в выдыхаемом воздухе.
Clin Infect Dis.
2008;46(1):93–95.
10.1086/523000
[PubMed] [CrossRef] [Google Scholar]

Способность устройства собирать бактерии из аэрозолей от кашля, выделяемых взрослыми с муковисцидозом

Версия 1. F1000Res. 2016; 5: 1920.

, A, 1, 2 , 2 , 3, 4 , 3, 4 , 5 , 5 и 6

Дэвид Н. Ку

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

Сара К.

Ку

2 MD Innovate, Inc., Декейтер, Джорджия, 30030, США

Бет Хелфман

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Наэль А. Маккарти

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Бернард Дж.Вольф

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Джонас М. Винчелл

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Ларри Дж. Андерсон

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

Дэвид Н. Ку, Наэль А. Маккарти, Бернард Дж. Вольф, Джонас М. Винчелл и Ларри Дж. Андерсон были научными консультантами. Бет Хелфман собирала данные, предоставляла и ухаживала за пациентами исследования. Сара К. Ку написала и отредактировала большую часть рукописи. Все авторы согласились с окончательным содержанием статьи.

Конкурирующие интересы: Д-р Дэвид Н. Ку, Сара К. Ку и д-р Ларри Дж. Андерсон являются соавторами патента PneumoniaCheck™, лицензированного MD Innovate, Inc. из Центров по контролю и профилактике заболеваний США и Джорджии. Корпорация технических исследований.

Эта статья находится в открытом доступе и распространяется в соответствии с лицензией Creative Commons Attribution, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

Эта статья была процитирована другими статьями в PMC.

Заявление о доступности данных

Данные, упомянутые в этой статье, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Аннотация

Исходная информация : Идентификация легочных патогенов и резких всплесков легочных показателей остается проблемой при лечении пациентов с кистозным фиброзом (МВ). Бактерии из глубоких отделов легких можно брать из аэрозолей, образующихся при кашле.

Методы : Новое устройство было использовано для сбора и измерения уровня бактерий в аэрозолях от кашля у пациентов с муковисцидозом. Образцы мокроты и полости рта также были собраны и измерены для сравнения. синегнойная палочка ,
Золотистый стафилококк ,
Klebsiella pneumoniae и
Streptococcus mitis были обнаружены в образцах с помощью молекулярных анализов полимеразной цепной реакции в реальном времени (RT-PCR).

Результаты : В исследовании приняли участие 20 взрослых пациентов с муковисцидозом и 10 здоровых людей из контрольной группы. Бактерии, связанные с CF (CFRB), были обнаружены в 13/20 (65%) образцах кашля по сравнению с 15/15 (100%) образцах мокроты. Комменсал
S. mitis присутствовал у 0/17 (0%, р=0.0002) образцы кашля и 13/14 (93%) образцов мокроты. В нормальных контрольных образцах в образцах от кашля не было собрано никаких бактерий, но 4/10 (40%) образцов из полости рта были положительными на CFRB.

Выводы : Неинвазивный сбор аэрозолей от кашля может обнаруживать патогены нижних дыхательных путей у пациентов с муковисцидозом с такой же специфичностью и чувствительностью, что и показатели, определяемые БАЛ, без контаминации пероральными CFRB или комменсальными бактериями.

Ключевые слова: Муковисцидоз, аэрозоли, сбор образцов, респираторные инфекции, этиология

Введение

Этиологию инфекций нижних дыхательных путей в легких трудно определить, отчасти потому, инфекция недоступна
1–
4
.Доступ к такому образцу был бы важным шагом вперед в мониторинге и лечении муковисцидоза (МВ), а также других инфекций нижних дыхательных путей, таких как пневмония, туберкулез, астма, рак легких и т. д. В настоящее время ротоглоточный (ОП) , мокрота и образцы бронхоальвеолярного лаважа (БАЛ) обычно используются для наблюдения за пациентами с муковисцидозом. Образцы OP могут подходить для обнаружения вирусов, но не идеальны для большинства бактериальных патогенов. Мокрота обычно собирается для мониторинга муковисцидоза, но часто содержит загрязнители и бактерии, связанные с муковисцидозом (CFRB) из верхних дыхательных путей.Трудности, с которыми сталкиваются некоторые пациенты при получении приемлемого образца мокроты, еще больше снижают ценность этих образцов, часто заставляя врача лечить пациента эмпирическим путем.
1–
4
. БАЛ дает образец из легких, но это инвазивная процедура, которую нельзя использовать в обычном порядке. Образцы БАЛ могут также собирать загрязняющие вещества из верхних дыхательных путей.
5–
7
.

Альтернативным источником образцов легких являются аэрозоли, образующиеся при кашле
8–
12
.Исследования показывают, что один кашель может генерировать до 66 000 выбрасываемых частиц.
10,
13
. Пациенты с инфекциями нижних дыхательных путей могут заражать других через респираторное распространение возбудителей в аэрозолях, образующихся при кашле или чихании. Кашель вызывает более высокую концентрацию патогенов из нижних отделов легких, чем обычный выдох или чихание.
8–
13
. Новое устройство для сбора образцов от кашля (PneumoniaCheck™,
) собирает аэрозоли из легких на фильтр с микропорами, сводя к минимуму загрязнение верхних дыхательных путей.Затем можно использовать микробиологические или молекулярные анализы для обнаружения патогенов, собранных на фильтре устройства.

Контейнер для хранения и транспортировки образцов PneumoniaCheck™.

В устройстве используется резервуар для отделения содержимого полости рта от аэрозолей глубоко в легких с использованием гидромеханики для разделения (
). Первоначальный объем воздуха, который поступает при выдохе или кашле, представляет собой загрязненный воздух из верхних дыхательных путей, также известный как анатомическое мертвое пространство. Когда пациент кашляет в аппарат, этот воздух из верхних дыхательных путей сначала попадает в резервуар (
).Выдыхаемый воздух сначала поступает в резервуар, так как он имеет наименьшее сопротивление по сравнению с фильтром на конце устройства. Этот резервуар имеет объем 250 мл, что примерно на 100 мл больше, чем объем анатомического мертвого пространства у среднего взрослого человека.
15 , что гарантирует полное отделение всех аэрозолей верхних дыхательных путей. Расширенный резервуар неэластичен, создавая противодавление, поэтому последующий выдыхаемый воздух принудительно проходит через микробный фильтр (
). Таким образом, на фильтр собирается только легочное аэрозольное содержимое, не загрязняющее верхние дыхательные пути.

Гидромеханическое разделение дыхательных путей PneumoniaCheck™.

(
a ) Загрязненные частицы верхних дыхательных путей изо рта сначала заполняют воздушный резервуар. (
b ) Затем незагрязненные частицы нижних дыхательных путей из легких улавливаются фильтром.

Предыдущее исследование показало, что фильтр устройства более чем на 99 % эффективен для сбора переносимых по воздуху бактерий (диаметром приблизительно 3,1 мкм) и вирусов (диаметром приблизительно 2,8 мкм).
16 .Отбор проб из контрольной группы здоровых людей показал нулевое скопление содержимого ротовой полости на фильтре, даже при наличии во рту до 15 мл жидкости (имитирующей мокроту). Было показано, что устройство PneumoniaCheck™ значительно отделяет газ в нижних дыхательных путях от газа в верхних дыхательных путях в зависимости от уровня кислорода и алкоголя (p<0,0001). 16 .

МВ — это генетическое заболевание, которое ежегодно поражает легкие примерно 28 000 детей и взрослых в США.
17 . Люди с муковисцидозом часто имеют хронические инфекции легких и нуждаются в регулярном наблюдении, чтобы гарантировать, что бактериальная колонизация не перерастет в инфекцию.
26, г.
27
.Мы использовали образцы мокроты и кашля, чтобы сравнить их способность улавливать, идентифицировать и количественно определять относительные уровни легочных бактерий у взрослых пациентов с муковисцидозом. Цель этого исследования — определить, может ли устройство от кашля улавливать легочные патогены взрослых пациентов с хронической легочной инфекцией, одновременно исключая оральные бактерии.

Материалы и методы

Субъекты

Пациенты с муковисцидозом (n=20) в возрасте старше 18 лет были набраны из клиники для взрослых Центра кистозного фиброза Эмори в Атланте, Джорджия.Институциональный наблюдательный совет Эмори ({“type”:”entrez-нуклеотид”,”attrs”:{“text”:”H08353″,”term_id”:”873175″,”term_text”:”H08353″}}H08353) одобрил исследование и участники предоставили письменное информированное согласие. Размер выборки был достаточно мощным, чтобы продемонстрировать статистическую значимость отбора проб нижних отделов легких без орального загрязнения. Тесты парных пропорций проводились с использованием точной формы теста Макнемара для сравнения наличия CFRB между двумя образцами (т.е. кашель и мокрота).Критерий знакового ранга Уилкоксона использовался для сравнения порога цикла (
С
T
) значения между различными методами выборки. То
С
T
Значение 60 использовалось в качестве верхнего предела обнаружения для всех анализов ПЦР для определения относительного количества бактерий в каждом образце.

Клинические измерения

Образцы мазков из горла и устройства от кашля были взяты у 10 здоровых некурящих субъектов для нормального контроля. Отдельно у 20 взрослых пациентов с муковисцидозом были взяты образцы мокроты и средства от кашля.Сбор образцов устройства для кашля предшествовал сбору образцов мокроты, чтобы помочь вызвать мокроту. Сбор образцов находился под наблюдением, и аварийное оборудование было легко доступно.
Streptococcus mitis — это комменсальная бактерия, которая обнаруживается во рту, но не в легких.
14 .
Streptococcus pneumoniae и
Staphylococcus aureus также часто обнаруживаются в ротовой полости.
3 .
синегнойная палочка ,
Staphylococcus aureus и
Klebsiella pneumoniae являются бактериями, родственными муковисцидозу (CFRB).
18–
20
.Образцы полости рта и кашля были проанализированы на наличие этих бактерий для определения уровня загрязнения полости рта.

Определение достаточного сбора аэрозолей

Система отбора проб аэрозолей от кашля Fennelly (CASS)
29, г.
30
и дистанционная установка Knibbs
13 продемонстрировали, что частицы кашля могут нести значительные концентрации бактерий от инфекций нижних дыхательных путей. В предыдущей статье об устройстве для сбора кашля описывается способность устройства выборочно брать пробы из нижних отделов легких, исключая загрязнения полости рта.
16 .Устройство для кашля, используемое в этом исследовании, представляет собой менее громоздкий вариант по сравнению с методами Феннелли и Ниббса для сбора образцов легких. Каждый пациент кашлянул в устройство 10 раз, чтобы обеспечить достаточный сбор аэрозоля.

Микробиология

Микробиологическое культивирование имеет ряд ограничений, которые снижают эффективность и действенность экспресс-диагностики
24 . Образцы из горла, мокроты и кашля были проанализированы с использованием методов молекулярной ПЦР. Все образцы были обработаны в безопасном шкафу BSL 2.Фильтр от кашля удаляли, помещали в стерильный морозильный флакон на 2 мл и хранили при -80°С. Респираторные выделения, захваченные фильтром, удаляли путем увлажнения фильтра 1 мл буфера для лизиса (буфер для лизиса MagNA Pure LC; Roche Applied Science, Индианаполис, Индиана), встряхивания, инкубации в течение 5 минут при комнатной температуре и сбора с помощью пипетки. Жидкость, оставшуюся в фильтре, собирали, помещая фильтр в стерильную микроцентрифужную пробирку Costar SpinX с фильтром 0,45 мкм (Corning Inc., Corning, NY), центрифугированием в течение 1 мин при 10 000 об/мин и выделением с помощью пипетки. Затем оставшуюся жидкость объединяли с исходной собранной жидкостью, а затем экстрагировали 400 мкл на приборе MagNA Pure Compact Instrument (Roche Applied Science) в соответствии с инструкциями производителя. Экстрагированную нуклеиновую кислоту элюировали в 100 мкл буфера для элюции и хранили при -80°C для тестирования количественной ПЦР.

Образец мокроты смешивали с 1 мл фосфатно-солевого буфера (PBS), гомогенизировали пипетированием и встряхиванием, смешивали с 12.5 мМ равных объемов свежеприготовленного дитиотреитола (DTT, формат No Weigh™, Fisher Scientific) и инкубировали при комнатной температуре в течение 30 минут с периодическим встряхиванием. Полученный раствор разделяли на аликвоты по 400 мкл и хранили при -80°С. Затем аликвоту обработанного образца объемом 400 мкл экстрагировали на приборе MagNA Pure Compact и хранили, как описано выше.

Экстрагированная нуклеиновая кислота была протестирована на
P. aeruginosa ,
S. aureus ,
К. pneumoniae и
С.mitis с помощью индивидуальных ПЦР в реальном времени. Последовательности праймеров и зондов для этих анализов были описаны ранее.
25 . То
Праймеры S. mitis : прямой TTTTGTCATCTAGCCTTGC; Обратный GCAGTCATATCATCACCTTC и зонд ACTTGGGCAATCCCGACAGATTCTAAC с 5′-репортером FAM и 3′-гасителем BHQ. Реакции ПЦР проводили с использованием 5 мкл выделенной из образцов нуклеиновой кислоты и 12,5 мкл PerfeCTa Multiplex qPCR SuperMix (каталожный номер

-200; Quanta BioSciences), 0.Конечные концентрации каждого праймера 5 мкМ, конечная концентрация зонда 0,1 мкМ и вода без нуклеаз (номер по каталогу P1193; Promega) до конечного реакционного объема 25 мкл. Реакции ПЦР в реальном времени проводили с использованием стандартной машины ABI 7500 (Life Technologies, Карлсбад, Калифорния) с активацией фермента при 95°C в течение 5 минут, с последующими 45 циклами при 95°C в течение 15 секунд и 60°C в течение 1 минуты. . Все образцы от пациентов с муковисцидозом анализировали в двух повторах для каждой мишени. То
С
T
Значения для отдельных анализов ПЦР использовались как показатель относительного количества бактерий в образце.

Результаты

Все испытуемые благополучно завершили сбор образцов. В качестве контроля использовали десять здоровых испытуемых. Образцы мокроты и кашля были успешно собраны у 20 взрослых пациентов с муковисцидозом, за исключением пяти пациентов, которые не смогли получить образец мокроты.

Нормальные контроли продемонстрировали высокую частоту ложноположительных результатов при пероральном отборе проб, как показано на рис.
. Бактерии были выделены из мазков из зева у 4/10 (40%) нормальных здоровых субъектов контрольной группы.
С.pneumoniae был положительным в 2/10 (20%) пероральных образцах и
S. aureus был положительным в 3/10 (30%) пероральных образцах, при этом у одного субъекта были обнаружены обе бактерии. Напротив, 0/10 (0%, p = 0,0313) образцов от кашля были положительными на наличие бактерий в контрольной группе. Рассчитанная доля истинных отрицательных результатов или специфичность для образцов мокроты составила 60% и 100% для образцов от кашля.

Таблица 1.

Обнаружение бактерий в образцах из горла и при кашле у нормальных здоровых людей.

5 2

5 отрицательный

5 3

5 4

5 6

5 7

5 8

5 отрицательный

5

5 отрицательный

5 отрицательный

5 10

Горло Кашель
1 S. aureus отрицательный
отрицательный
отрицательный отрицательный
4 S. aureus Отрицательный
5 S. aureus ,
S.pneumoniae
отрицательный
отрицательный отрицательный
отрицательный отрицательный
8 С. пневмонии
Отрицательный Отрицательный

Специфика в CF пациентам было похоже. Для пациентов с муковисцидозом
S. mitis был выделен из 13/14 (93%) образцов мокроты, но ни в одном из образцов кашля (0%, p = 0,0002). Образцы от кашля, собранные не
S. mitis . CFRB был собран в образцах обоих типов. P. aeruginosa был выделен из 13/15 (87%) образцов мокроты и 9/20 (45%) образцов кашля (р=0,0213).
S. aureus был выделен из 9/15 (60%) образцов мокроты и 3/20 (15%) образцов кашля.
K. pneumoniae был выделен из 2/15 (13%) образцов мокроты и 3/20 (15%) образцов кашля.

В совокупности образцы мокроты были положительными на CFRB в 15/15 (100%) образцах. Образцы кашля были положительными на CFRB в 13/20 (65%) образцах. Образцы мокроты содержали 93% оральных комменсалов.Образцы мокроты были положительными в отношении трех и более возбудителей в 2/15 (13%) образцов и положительных в отношении двух и более возбудителей в 7/15 (47%) образцов. Напротив, образцы от кашля не имели комменсалов и были положительными у 65% пациентов с муковисцидозом. Образцы кашля были положительными на два или более возбудителей в 2/20 (10%, p<0,05) образцах, и ни один образец кашля не был положительным на три или более возбудителей. Результаты этих идентификаций ПЦР в реальном времени перечислены в .

Таблица 2.

Обнаружение бактерий в образцах мокроты и кашля взрослых пациентов с муковисцидозом.

5

5
2+ возбудителя

Мокрота Кашель
n=15* %

С
Т


диапазон
n=20 % С
Т


диапазон
P. aeruginosa 13/15 87% 18–33 2/20 45% 33–42
С.золотистый 9/15 60% 24–38 3/20 15% 36–40
К.пневмония 2/15 13% 37–38 3/20 15% 39–43
CFRB всего 15/15 100 % 18–38 13/20 65 % 33–43
7/15 47% 18–38 2/20 10% 36–43
3+ возбудителя 2/15 13% 18–38 0/20 0% Н/Д
С. митис 13/14† 93% 24–41 0/17§ 0% Н/Д

С
T
значения обратно пропорциональны количеству бактерий в образце, т. е. малые значения указывают на большее количество колониеобразующих единиц (КОЕ). Для образцов CFRB,
P. aeruginosa С
T
значения варьировались от 18–33 в образцах мокроты и 33–42 в образцах кашля.
S. aureus C
T
значения варьировались от 24–38 в образцах мокроты и 36–40 в образцах кашля.Для обоих
P. aeruginosa и
S. aureus образцы кашля и мокроты значительно различались по
С
T
значений (p=0,0017 и 0,0092 соответственно).
К. пневмонии C
T
значения варьировались от 37–38 в образцах мокроты и 39–43 в образцах кашля. Таким образом
С
T
значения для образцов кашля были постоянно выше, чем для мокроты. Обратите внимание, что образцы кашлевого фильтра от нормальных контролей не обнаруживали патогенов вплоть до
С
T
значений 60.

Обсуждение

Общепризнанно, что для сбора патогенов нижних дыхательных путей необходим простой, безопасный, неинвазивный, не требующий особого ухода, недорогой, широко доступный пробоотборник.
34–
37
.

Сбор содержимого нижних отделов легких при кашле намного проще, чем сбор образцов БАЛ. Метод удобен для пациентов, которые уже склонны к кашлю и сообщают, что использование аппарата помогло очистить легкие. Образцы кашля могут служить неинвазивным, но специфическим образцом для наблюдения на дому с целью наблюдения за всплесками легочных патогенов у пациентов с муковисцидозом. Использование устройства для сбора аэрозолей от кашля потенциально может стать чистой альтернативой пероральным образцам для обнаружения патогенов нижних отделов легких.

Как известно, обычно используемые образцы мокроты или мазков из ОП показывают сильное загрязнение верхних дыхательных путей
3,
4
. Почти все образцы мокроты были положительными на оральные комменсалы.
S. mitis . Напротив, ни один из образцов кашля не был положительным на
S. mitis . Это различие в комменсалах
С.mitis между образцами мокроты и кашля подтверждает ненадежность и низкую специфичность мокроты.
3,
4
. Кроме того, не все пациенты могут получить адекватный образец мокроты. Обследование 12 субъектов с парной мокротой и
Результаты S. mitis , 8/12 (67%) образцов мокроты и кашля дали согласующиеся положительные результаты, хотя шесть из этих восьми были положительными на наличие дополнительных бактерий в мокроте. Эти шесть образцов мокроты с множественными бактериями, вероятно, указывают на ложноположительные результаты от перорального загрязнения, а не от коинфекции.

Количество конкордантных образцов мокроты и кашля (2/12, 17%) было небольшим. И наоборот, патоген, обнаруженный в образце кашля, отличался от наблюдаемого в образце мокроты. В 2/12 (17%) образцах мокроты не были идентифицированы бактерии, которые были идентифицированы в образцах кашля, что, возможно, отражает маскированные показания, связанные с комменсальным отвлечением. Различия демонстрируют, что устройство от кашля не просто собирает мокроту.

P. aeruginosa — наиболее распространенная бактерия, обнаруживаемая в легких взрослых пациентов с муковисцидозом.
19 , а также была самой распространенной бактерией, собранной в нашей когорте.13/20 (65%) образцов кашля были положительными на CFRB. Эта заболеваемость и распределение патогенов при муковисцидозе аналогичны 59% положительных результатов на CFRB в пробах БАЛ.
22, г.
23
. Предыдущие серии образцов БАЛ в аналогичных популяциях дали положительный CFRB 59–85%, что аналогично 65% положительности от устройства для кашля, иллюстрирующего сопоставимую чувствительность.
22, г.
23
.

Сбор выдыхаемых аэрозолей изучался несколькими предыдущими группами. Альтернативным устройством для сбора аэрозолей является RTube™; однако он сильно различается по дизайну и функциям
28 .Система RTube™ предназначена для сбора всего выдыхаемого воздуха, который конденсируется.
28 , в то время как PneumoniaCheck™ предназначен для сбора аэрозолей в легких размером с частицы и отделения содержимого рта
16 . Большая часть выдыхаемого газа выходит из конца RTtube™, так как предназначен только для сбора водяного конденсата. Конденсат выдыхаемого воздуха может быть полезным образцом для определения уровня pH, но, как правило, не считается надежным образцом для выявления инфекций нижних дыхательных путей.
34–
37
.

Уэйнрайт
и др. ., сообщили об обнаружении
P. aeruginosa в аэрозолях от кашля по культуре
12 . Они сообщили о 25 из 28 (89%) положительных результатов в смешанной популяции детей и взрослых с муковисцидозом с использованием системы отбора проб аэрозолей от кашля (CASS) в течение 5 минут с каждым субъектом.
12 . Аналогично, Ниббс
и др. сообщили, что 14 из 18 (78%) пациентов подверглись аэрозольной
P. aeruginosa , которые оставались жизнеспособными и предположительно трансмиссивными в течение 45 минут после кашля, взятого с помощью импактора Андерсона.
13 .Ниббс
и др. . использовали обычные микробиологические культуры для количественного определения колониеобразующих единиц. В обоих этих исследованиях использовался специально сконструированный пробоотборник аэрозолей, который является дорогим, громоздким и сложным для использования в клинических условиях. Для этих исследований пациенты кашляют в стандартный мундштук, а аэрозоли всасываются в импакторы с помощью вакуумных воздушных насосов. Система CASS не предназначена для рутинного использования в клинических условиях, а мундштук не предназначен для исключения содержимого полости рта. Эти конструкции отличаются от PneumoniaCheck™, который имеет мундштук, специально предназначенный для исключения загрязнения ротовой полости.
16 .Высокая заболеваемость
P. aeruginosa при использовании мундштука и трубки типа трубки может отражать некоторый сбор содержимого полости рта с помощью CASS.

ОТ-ПЦР можно использовать для количественного определения количества патогенов в образце. Чем больше материала собирается на фильтре, тем
С
T
количество отсчетов упадет подобно обратному значению КОЕ
32 . Следует отметить, что аэрозольный образец легкого должен иметь более высокую
С
T
значений по сравнению с жидкими образцами мокроты из-за отсутствия контаминации и небольшого физического объема аэрозолей. С
T
значения в образцах мокроты колебались от 19 до 38, а в образцах от кашля – от 33 до 43 (p<0,001, ). Тем не менее, С
T
значения во всех положительных образцах от кашля значительно ниже исходного уровня >60 для нормального контроля. В то время как
С
T
значения выше для образцов от кашля, уровень фонового шума первичного фильтра >60, что допускает пределы обнаружения методом ПЦР, который может быть более чувствительным к CFRB легких.

Таблица 3.


С
T
значения образцов мокроты и кашля, сгруппированные по возбудителям.

2

5 N / A

5 N / A

5 N / A

5 6 9 0023

7

70023

9005 N / A

N / A

5 –

5 10

5 N / A

5 38

5 –

5 29

5 –

Субъект P. aeruginosa S. aureus К. пневмонии С. mitis
# Мокрота Кашля Мокроты Кашля Мокроты Кашель Мокроты Кашель
1 22 33 41
N / A 42 N / A
3 32 32
4 21 41 36 24
5 N / A N / A N / A
18 41 32
N / A N / A
N / A 35 N / A N / A
9 N / A N / A N / A N / A N / A 43 31
19 38 40 37 37 N / A
11 19 42 27 N / A N / A
12 20 30
13 33 39 30 33
14 33 40 24 33
15 37 32
16 25 31
17 33 39 27
25
19 25 39 29 39 29
20 22 42 34 Н/Д

Можно использовать
С
T
значений для сравнения относительного количества патогенов, выделяемых при кашле у отдельного пациента, по сравнению с популяцией
32, г.
33
.Джонс-Лопес
и др. обнаружили, что как больные муковисцидозом, так и больные туберкулезом могут образовывать аэрозоли с жизнеспособными патогенами, но количество патогенов, вырабатываемых отдельными людьми, сильно различается.
31 . Пациенты с большим количеством
M. tuberculosis в аэрозолях от кашля с большей вероятностью передавались другим
30 . Те, которые производят большое количество патогенов при кашле, могут быть более эффективными переносчиками, например. «суперраспределители»
13, г.
30
. Количество патогенов в кашле может быть критическим показателем передачи инфекционных заболеваний, борьбы с эпидемиями и мониторинга колонизации.В Джонс-Лопес
и др. . исследование, количество аэрозольных
M.tuberculosis резко снизилась после трех недель лечения. Таким образом, образец кашля также можно использовать для мониторинга уровня резистентных бактерий, если они присутствуют.

В опубликованных руководствах для пациентов с муковисцидозом предлагается ежеквартально собирать образцы из дыхательных путей для мониторинга легочных инфекций
26, г.
27
. Образцы кашля могут быть более специфичным и чувствительным методом мониторинга колонизации и определения инфекционности.Дополнительные исследования могут дополнительно изучить это приложение путем сравнения
С
T
значений с симптомами. Если за пациентом с муковисцидозом регулярно наблюдают, используя образцы от кашля, внезапное снижение
С
T Значение
может указывать на изменение бремени патогенов
32, г.
33
. То
С
T
Величина содержания патогенов в аэрозолях от кашля может быть полезной в качестве меры для определения того, растет ли количество возбудителей в легких.

Это исследование имеет несколько ограничений.В наше исследование были включены только взрослые пациенты; таким образом, мы не можем комментировать образование аэрозоля при кашле у детей. В этом исследовании сообщается о 20 пациентах. В большинстве исследований, опубликованных в литературе, задействовано одинаковое количество субъектов, поскольку идентификация нижних дыхательных путей всегда была огромной проблемой.
12, г.
13
. Будущие исследования могут оценить преимущества необходимости большего количества кашля или кашля в течение определенного периода времени, например 5 минут, для установления
С
T
пороговые значения для этого нового метода сбора образцов.Молекулярные анализы RT-PCR, использованные в этом исследовании, доступны не во всех больницах, хотя несколько коммерческих лабораторий могут предоставлять услуги по клинической респираторной идентификации.

Заключение

Таким образом, мы показали, что новое устройство может собирать легочные патогены взрослых пациентов с муковисцидозом из аэрозолей от кашля с идентификацией с помощью молекулярного анализа. Устройство исключает загрязнения полости рта, показывая более высокую специфичность, чем образцы мокроты. Выявление возбудителей в нижних дыхательных путях, вероятно, сыграет важную роль в лечении пациентов.
24 .Данные этого исследования предлагают альтернативу сбору мокроты для идентификации возбудителей нижних дыхательных путей.

Согласие

Письменное информированное согласие было получено всеми участниками в соответствии с протоколом Институционального наблюдательного совета № 000-2492, утвержденным Технологическим институтом Джорджии, Университетом Эмори и Центрами США по контролю и профилактике заболеваний.

Доступность данных

Данные, на которые ссылается эта статья, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Примечания

[версия 1; рефери: одобрено 2]

Заявление о финансировании

При поддержке внутренних грантов Центров США по контролю и профилактике заболеваний и Университетской больницы Эмори.

Спонсоры не участвовали в разработке дизайна исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Каталожные номера

1.
Бернс МВт:
Преципитины к клебсиеллам и другим энтеробактериям в сыворотке крови больных хроническими респираторными заболеваниями. Ланцет.
1968; 1 (7539): 383–385.
10.1016/С0140-6736(68)-6
[PubMed] [CrossRef] [Google Scholar]2.
Годдард А.Ф., Штаудингер Б.Дж., Дауд С.Е. и др. :
Прямые пробы легких при муковисцидозе указывают на то, что анализы образцов верхних дыхательных путей на основе ДНК могут искажать микробиоту легких.
Proc Natl Acad Sci U S A.
2012;109(34):13769–13774.
10.1073/пнас.1107435109

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3.
Лентино-младший, Лакс Д.А.:
Неценность посева мокроты при лечении инфекций нижних дыхательных путей. J Clin Microbiol.
1987; 25(5):758–762.

[Бесплатная статья PMC] [PubMed] [Google Scholar]4.
Розенфельд М., Эмерсон Дж., Аккурсо Ф. и др. :
Диагностическая точность культур из ротоглотки у младенцев и детей раннего возраста с муковисцидозом.
Педиатр Пульмонол.
1999;28(5):321–328.
10.1002/(SICI)1099-0496(199911)28:5<321::AID-PPUL3>3.0.CO;2-V
[PubMed] [CrossRef] [Google Scholar]5.
Гилкрист Ф.Дж., Саламат С., Клейтон С. и др. :
Бронхоальвеолярный лаваж у детей с муковисцидозом: сколько долей следует брать?
Арч Ди Чайлд.
2011;96:215–217.
10.1136/доп.2009.177618
[PubMed] [CrossRef] [Google Scholar]6.
Уилнер Д., Хейнс М.Р., Фурлан М. и др. :
Пространственное распределение микробных сообществ в легком при муковисцидозе.
ИСМЕ Дж.
2012;6(2):471–474.
10.1038/исмей.2011.104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7.
Уимберли Н., Фалинг Л.Дж., Бартлетт Дж.Г.:
Метод фиброоптической бронхоскопии для получения незагрязненных выделений из нижних дыхательных путей для бактериального посева.
Am Rev Respir Dis.
1979;119(3):337–343.
[PubMed] [Google Scholar]8.
Коуч Р.Б., Кейт Т.Р., Дуглас Р.Г.-младший и др. :
Влияние пути прививки на экспериментальное респираторное вирусное заболевание у добровольцев и доказательства воздушно-капельной передачи.
Бактериол Ред.
1966; 30 (3): 517–529.

[Бесплатная статья PMC] [PubMed] [Google Scholar]9.
Коуч Р.Б., Кейт Т.Р., Героне П.Дж. и др. :
Появление болезни с помощью мелкодисперсного аэрозоля Коксаки А
21 .
Дж Клин Инвест.
1965; 44 (4): 535–542.10.1172/ДЖКИ105166

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10.
Gerone PJ, Couch RB, Keefer GV и др. :
Оценка экспериментальных и природных вирусных аэрозолей.
Бактериол Ред.
1966; 30 (3): 576–584.

[Бесплатная статья PMC] [PubMed] [Google Scholar]11.
Ли Н., Чан П.К., Хуэй Д.С. и др. :
Вирусная нагрузка и продолжительность выделения вируса у взрослых пациентов, госпитализированных с гриппом.
J Заразить Dis.
2009;200(4):492–500.
10.1086/600383
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12.Уэйнрайт К.Э., Франция М.В., О’Рурк П. и др. :
Аэрозоли, вызываемые кашлем
Pseudomonas aeruginosa и другие грамотрицательные бактерии от пациентов с муковисцидозом.
Грудная клетка.
2009;64(11):926–931.
10.1136/thx.2008.112466

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13.
Ниббс Л.Д., Джонсон Г.Р., Кидд Т.Дж. и др. :
Жизнеспособность
Pseudomonas aeruginosa в аэрозолях от кашля, выделяемых людьми с муковисцидозом.
Грудная клетка.
2014;69(8):740–745.10.1136/thoraxjnl-2014-205213

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14.
Лильемарк В.Ф., Гиббонс Р.Дж.:
Пропорциональное распределение и относительная адгезия стрептококковых клещей (
mitis ) на различных поверхностях ротовой полости человека.
Заразить иммунн.
1972; 6 (5): 852–859.

[Бесплатная статья PMC] [PubMed] [Google Scholar]15.
Hart MC, Orzalesi MM, Cook CD:
Связь между анатомическим мертвым пространством дыхательных путей, размерами тела и объемом легких.
J Appl Physiol.
1963; 18 (3): 519–522.Справочный источник
[Google Академия] 16.
Scholz TL, Midha PA, Anderson LJ, et al. :
PneumoniaCheck: устройство для отбора проб аэрозолей из нижних дыхательных путей.
J Med Devices.
2010;4(4):041005
10.1115/1.4002760
[Перекрестная ссылка] [Академия Google] 17.
Реестр пациентов Фонда кистозного фиброза: Ежегодный отчет о данных за 2013 г. для директоров Центра. Бетесда, Мэриленд. 2014 г. [Google Академия] 18.
Фернесс Дж. К., Хабеб А., Спенсер Д. А. и соавт. :
В редакцию: Бронхоальвеолярный лаваж (БАЛ) при педиатрическом муковисцидозе (МВ): его клиническое применение, модифицированное аудитом в региональном центре МВ. Педиатр Пульмонол.
2002;33(3):234.
10.1002/стр.10052
[PubMed] [CrossRef] [Google Scholar] 20.
Рэмси Б.В., Венц К.Р., Смит А.Л. и соавт. :
Прогностическая ценность культур ротоглотки для выявления бактерий нижних дыхательных путей у пациентов с муковисцидозом.
Am Rev Respir Dis.
1991;144(2):331–337.
10.1164/ajrccm/144.2.331
[PubMed] [CrossRef] [Google Scholar] 21.
Армстронг Д.С., Гримвуд К., Карлин Дж.Б. и др. :
Бронхоальвеолярный лаваж или посев из ротоглотки для выявления патогенов нижних дыхательных путей у младенцев с муковисцидозом. Педиатр Пульмонол.
1996;21(5):267–275.
10.1002/(SICI)1099-0496(199605)21:5<267::AID-PPUL1>3.0.CO;2-K
[PubMed] [CrossRef] [Google Scholar] 22.
Harris JK, De Groote MA, Sagel SD, et al. :
Молекулярная идентификация бактерий в жидкости бронхоальвеолярного лаважа у детей с муковисцидозом.
Proc Natl Acad Sci U S A.
2007;104(51):20529–20533.
10.1073/пнас.0709804104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]23.
Zemanick ET, Wagner BD, Harris JK, et al.:
Легочные обострения при муковисцидозе с отрицательными бактериальными культурами.
Педиатр Пульмонол.
2010;45(6):569–577.
10.1002/стр.21221

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]24.
Oosterheert JJ, Bonten MJ, Buskens E, et al. :
Алгоритм определения экономии затрат на таргетную антимикробную терапию по результатам экспресс-диагностики.
J Clin Microbiol.
2003;41(10):4708–4713.
10.1128/JCM.41.10.4708-4713.2003

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25.Эмери С.Л., Эрдман Д.Д., Боуэн М.Д. и соавт. :
Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для коронавируса, связанного с SARS.
Emer Infect Dis.
2004;10(2):311–316.
10.3201/eid1002.030759

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]26.
Сайман Л., Сигел Дж.,
Фонд муковисцидоза:
Рекомендации по инфекционному контролю для пациентов с муковисцидозом: микробиология, важные патогены и методы инфекционного контроля для предотвращения передачи инфекции от пациента к пациенту. Infect Control Hosp Epidemiol.
2003; 24 (5 Дополнение): S6–52.
10.1086/503485
[PubMed] [CrossRef] [Google Scholar] 27.
Yankaskas JR, Marshall BC, Sufian B, et al. :
Уход за взрослыми при муковисцидозе: консенсусный отчет конференции.
Сундук.
2004; 125 (1 Приложение): 1С–39С.
10.1378/грудь.125.1_доп.1С
[PubMed] [CrossRef] [Google Scholar] 28.
Сойер О.У., Диздар Э.А., Кескин О. и соавт. :
Сравнение двух методов сбора конденсата выдыхаемого воздуха.
Аллергия.
2006;61(8):1016–1018.
10.1111/j.1398-9995.2006.01064.x
[PubMed] [CrossRef] [Google Scholar] 29.
Феннелли К.П., Мартини Дж.В., Фултон К.Е. и др. :
Аэрозоли, вызываемые кашлем
Mycobacterium tuberculosis : новый метод изучения инфекционности.
Am J Respir Crit Care Med.
2004;169(5):604–609.
10.1164/rccm.200308-1101OC
[PubMed] [CrossRef] [Google Scholar] 30.
Феннелли К.П., Джонс-Лопес Э.К., Аякака И. и др. :
Изменчивость инфекционных аэрозолей, образующихся при кашле у больных туберкулезом легких. Am J Respir Crit Care Med.
2012;186(5):450–457.
10.1164/rccm.201203-0444OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]31.
Джонс-Лопес Э.К., Намугга О., Мамбова Ф. и др. :
аэрозоли от кашля
Mycobacterium tuberculosis предсказывают новую инфекцию: исследование бытовых контактов.
Am J Respir Crit Care Med.
2013;187(9):1007–1015.
10.1164/rccm.201208-1422OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]32.
Мехта Т., МакГрат Э., Бхимредди С. и др.:
Обнаружение устойчивости к осельтамивиру во время лечения инфекции вируса гриппа h2N1 2009 у пациентов с ослабленным иммунитетом: полезность пороговых значений цикла качественной ПЦР с обратной транскриптазой в реальном времени.
J Clin Microbiol.
2010;48(11):4326–4328.
10.1128/JCM.01190-10

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]33.
Эспи М.Дж., Уль Дж.Р., Слоан Л.М. и др. :
ПЦР в реальном времени в клинической микробиологии: приложения для рутинных лабораторных испытаний.
Clin Microbiol, версия
2006;19(1):165–256.10.1128/CMR.19.1.165-256.2006

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]34.
Xu Z, Shen F, Li X и др. :
Молекулярный и микроскопический анализ бактерий и вирусов в выдыхаемом воздухе, собранном с помощью простого метода импакции и конденсации.
PLoS Один.
2012;7(7):e41137.
10.1371/journal.pone.0041137

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]35.
Хауспи Л., Де Костер С., Кейартс Э. и др. :
Отбор проб конденсата выдыхаемого воздуха не является новым методом обнаружения респираторных вирусов. Вирол Дж.
2011;8:98.
10.1186/1743-422Х-8-98

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]36.
Фабиан П., Макдевитт Дж. Дж., ДеХаан В. Х. и др. :
Вирус гриппа в выдыхаемом воздухе человека: обсервационное исследование.
PLoS Один.
2008;3(7):e2691.
10.1371/journal.pone.0002691

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]37.
Huynh KN, Oliver BG, Stelzer S, et al. :
Новый метод отбора проб и обнаружения аэрозолей респираторных вирусов в выдыхаемом воздухе.
Clin Infect Dis.
2008;46(1):93–95.
10.1086/523000
[PubMed] [CrossRef] [Google Scholar]

Способность устройства собирать бактерии из аэрозолей от кашля, выделяемых взрослыми с муковисцидозом

Версия 1. F1000Res. 2016; 5: 1920.

, A, 1, 2 , 2 , 3, 4 , 3, 4 , 5 , 5 и 6

Дэвид Н. Ку

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

Сара К.Ку

2 MD Innovate, Inc., Декейтер, Джорджия, 30030, США

Бет Хелфман

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Наэль А. Маккарти

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Бернард Дж.Вольф

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Джонас М. Винчелл

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Ларри Дж. Андерсон

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

Дэвид Н.Ку, Наэль А. Маккарти, Бернард Дж. Вольф, Джонас М. Винчелл и Ларри Дж. Андерсон были научными консультантами. Бет Хелфман собирала данные, предоставляла и ухаживала за пациентами исследования. Сара К. Ку написала и отредактировала большую часть рукописи. Все авторы согласились с окончательным содержанием статьи.

Конкурирующие интересы: Д-р Дэвид Н. Ку, Сара К. Ку и д-р Ларри Дж. Андерсон являются соавторами патента PneumoniaCheck™, лицензированного MD Innovate, Inc. из Центров по контролю и профилактике заболеваний США и Джорджии. Корпорация технических исследований.

Эта статья находится в открытом доступе и распространяется в соответствии с лицензией Creative Commons Attribution, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

Эта статья была процитирована другими статьями в PMC.

Заявление о доступности данных

Данные, упомянутые в этой статье, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Аннотация

Исходная информация : Идентификация легочных патогенов и резких всплесков легочных показателей остается проблемой при лечении пациентов с кистозным фиброзом (МВ). Бактерии из глубоких отделов легких можно брать из аэрозолей, образующихся при кашле.

Методы : Новое устройство было использовано для сбора и измерения уровня бактерий в аэрозолях от кашля у пациентов с муковисцидозом. Образцы мокроты и полости рта также были собраны и измерены для сравнения. синегнойная палочка ,
Золотистый стафилококк ,
Klebsiella pneumoniae и
Streptococcus mitis были обнаружены в образцах с помощью молекулярных анализов полимеразной цепной реакции в реальном времени (RT-PCR).

Результаты : В исследовании приняли участие 20 взрослых пациентов с муковисцидозом и 10 здоровых людей из контрольной группы. Бактерии, связанные с CF (CFRB), были обнаружены в 13/20 (65%) образцах кашля по сравнению с 15/15 (100%) образцах мокроты. Комменсал
S. mitis присутствовал у 0/17 (0%, р=0.0002) образцы кашля и 13/14 (93%) образцов мокроты. В нормальных контрольных образцах в образцах от кашля не было собрано никаких бактерий, но 4/10 (40%) образцов из полости рта были положительными на CFRB.

Выводы : Неинвазивный сбор аэрозолей от кашля может обнаруживать патогены нижних дыхательных путей у пациентов с муковисцидозом с такой же специфичностью и чувствительностью, что и показатели, определяемые БАЛ, без контаминации пероральными CFRB или комменсальными бактериями.

Ключевые слова: Муковисцидоз, аэрозоли, сбор образцов, респираторные инфекции, этиология

Введение

Этиологию инфекций нижних дыхательных путей в легких трудно определить, отчасти потому, инфекция недоступна
1–
4
.Доступ к такому образцу был бы важным шагом вперед в мониторинге и лечении муковисцидоза (МВ), а также других инфекций нижних дыхательных путей, таких как пневмония, туберкулез, астма, рак легких и т. д. В настоящее время ротоглоточный (ОП) , мокрота и образцы бронхоальвеолярного лаважа (БАЛ) обычно используются для наблюдения за пациентами с муковисцидозом. Образцы OP могут подходить для обнаружения вирусов, но не идеальны для большинства бактериальных патогенов. Мокрота обычно собирается для мониторинга муковисцидоза, но часто содержит загрязнители и бактерии, связанные с муковисцидозом (CFRB) из верхних дыхательных путей.Трудности, с которыми сталкиваются некоторые пациенты при получении приемлемого образца мокроты, еще больше снижают ценность этих образцов, часто заставляя врача лечить пациента эмпирическим путем.
1–
4
. БАЛ дает образец из легких, но это инвазивная процедура, которую нельзя использовать в обычном порядке. Образцы БАЛ могут также собирать загрязняющие вещества из верхних дыхательных путей.
5–
7
.

Альтернативным источником образцов легких являются аэрозоли, образующиеся при кашле
8–
12
.Исследования показывают, что один кашель может генерировать до 66 000 выбрасываемых частиц.
10,
13
. Пациенты с инфекциями нижних дыхательных путей могут заражать других через респираторное распространение возбудителей в аэрозолях, образующихся при кашле или чихании. Кашель вызывает более высокую концентрацию патогенов из нижних отделов легких, чем обычный выдох или чихание.
8–
13
. Новое устройство для сбора образцов от кашля (PneumoniaCheck™,
) собирает аэрозоли из легких на фильтр с микропорами, сводя к минимуму загрязнение верхних дыхательных путей.Затем можно использовать микробиологические или молекулярные анализы для обнаружения патогенов, собранных на фильтре устройства.

Контейнер для хранения и транспортировки образцов PneumoniaCheck™.

В устройстве используется резервуар для отделения содержимого полости рта от аэрозолей глубоко в легких с использованием гидромеханики для разделения (
). Первоначальный объем воздуха, который поступает при выдохе или кашле, представляет собой загрязненный воздух из верхних дыхательных путей, также известный как анатомическое мертвое пространство. Когда пациент кашляет в аппарат, этот воздух из верхних дыхательных путей сначала попадает в резервуар (
).Выдыхаемый воздух сначала поступает в резервуар, так как он имеет наименьшее сопротивление по сравнению с фильтром на конце устройства. Этот резервуар имеет объем 250 мл, что примерно на 100 мл больше, чем объем анатомического мертвого пространства у среднего взрослого человека.
15 , что гарантирует полное отделение всех аэрозолей верхних дыхательных путей. Расширенный резервуар неэластичен, создавая противодавление, поэтому последующий выдыхаемый воздух принудительно проходит через микробный фильтр (
). Таким образом, на фильтр собирается только легочное аэрозольное содержимое, не загрязняющее верхние дыхательные пути.

Гидромеханическое разделение дыхательных путей PneumoniaCheck™.

(
a ) Загрязненные частицы верхних дыхательных путей изо рта сначала заполняют воздушный резервуар. (
b ) Затем незагрязненные частицы нижних дыхательных путей из легких улавливаются фильтром.

Предыдущее исследование показало, что фильтр устройства более чем на 99 % эффективен для сбора переносимых по воздуху бактерий (диаметром приблизительно 3,1 мкм) и вирусов (диаметром приблизительно 2,8 мкм).
16 .Отбор проб из контрольной группы здоровых людей показал нулевое скопление содержимого ротовой полости на фильтре, даже при наличии во рту до 15 мл жидкости (имитирующей мокроту). Было показано, что устройство PneumoniaCheck™ значительно отделяет газ в нижних дыхательных путях от газа в верхних дыхательных путях в зависимости от уровня кислорода и алкоголя (p<0,0001). 16 .

МВ — это генетическое заболевание, которое ежегодно поражает легкие примерно 28 000 детей и взрослых в США.
17 . Люди с муковисцидозом часто имеют хронические инфекции легких и нуждаются в регулярном наблюдении, чтобы гарантировать, что бактериальная колонизация не перерастет в инфекцию.
26, г.
27
.Мы использовали образцы мокроты и кашля, чтобы сравнить их способность улавливать, идентифицировать и количественно определять относительные уровни легочных бактерий у взрослых пациентов с муковисцидозом. Цель этого исследования — определить, может ли устройство от кашля улавливать легочные патогены взрослых пациентов с хронической легочной инфекцией, одновременно исключая оральные бактерии.

Материалы и методы

Субъекты

Пациенты с муковисцидозом (n=20) в возрасте старше 18 лет были набраны из клиники для взрослых Центра кистозного фиброза Эмори в Атланте, Джорджия.Институциональный наблюдательный совет Эмори ({“type”:”entrez-нуклеотид”,”attrs”:{“text”:”H08353″,”term_id”:”873175″,”term_text”:”H08353″}}H08353) одобрил исследование и участники предоставили письменное информированное согласие. Размер выборки был достаточно мощным, чтобы продемонстрировать статистическую значимость отбора проб нижних отделов легких без орального загрязнения. Тесты парных пропорций проводились с использованием точной формы теста Макнемара для сравнения наличия CFRB между двумя образцами (т.е. кашель и мокрота).Критерий знакового ранга Уилкоксона использовался для сравнения порога цикла (
С
T
) значения между различными методами выборки. То
С
T
Значение 60 использовалось в качестве верхнего предела обнаружения для всех анализов ПЦР для определения относительного количества бактерий в каждом образце.

Клинические измерения

Образцы мазков из горла и устройства от кашля были взяты у 10 здоровых некурящих субъектов для нормального контроля. Отдельно у 20 взрослых пациентов с муковисцидозом были взяты образцы мокроты и средства от кашля.Сбор образцов устройства для кашля предшествовал сбору образцов мокроты, чтобы помочь вызвать мокроту. Сбор образцов находился под наблюдением, и аварийное оборудование было легко доступно.
Streptococcus mitis — это комменсальная бактерия, которая обнаруживается во рту, но не в легких.
14 .
Streptococcus pneumoniae и
Staphylococcus aureus также часто обнаруживаются в ротовой полости.
3 .
синегнойная палочка ,
Staphylococcus aureus и
Klebsiella pneumoniae являются бактериями, родственными муковисцидозу (CFRB).
18–
20
.Образцы полости рта и кашля были проанализированы на наличие этих бактерий для определения уровня загрязнения полости рта.

Определение достаточного сбора аэрозолей

Система отбора проб аэрозолей от кашля Fennelly (CASS)
29, г.
30
и дистанционная установка Knibbs
13 продемонстрировали, что частицы кашля могут нести значительные концентрации бактерий от инфекций нижних дыхательных путей. В предыдущей статье об устройстве для сбора кашля описывается способность устройства выборочно брать пробы из нижних отделов легких, исключая загрязнения полости рта.
16 .Устройство для кашля, используемое в этом исследовании, представляет собой менее громоздкий вариант по сравнению с методами Феннелли и Ниббса для сбора образцов легких. Каждый пациент кашлянул в устройство 10 раз, чтобы обеспечить достаточный сбор аэрозоля.

Микробиология

Микробиологическое культивирование имеет ряд ограничений, которые снижают эффективность и действенность экспресс-диагностики
24 . Образцы из горла, мокроты и кашля были проанализированы с использованием методов молекулярной ПЦР. Все образцы были обработаны в безопасном шкафу BSL 2.Фильтр от кашля удаляли, помещали в стерильный морозильный флакон на 2 мл и хранили при -80°С. Респираторные выделения, захваченные фильтром, удаляли путем увлажнения фильтра 1 мл буфера для лизиса (буфер для лизиса MagNA Pure LC; Roche Applied Science, Индианаполис, Индиана), встряхивания, инкубации в течение 5 минут при комнатной температуре и сбора с помощью пипетки. Жидкость, оставшуюся в фильтре, собирали, помещая фильтр в стерильную микроцентрифужную пробирку Costar SpinX с фильтром 0,45 мкм (Corning Inc., Corning, NY), центрифугированием в течение 1 мин при 10 000 об/мин и выделением с помощью пипетки. Затем оставшуюся жидкость объединяли с исходной собранной жидкостью, а затем экстрагировали 400 мкл на приборе MagNA Pure Compact Instrument (Roche Applied Science) в соответствии с инструкциями производителя. Экстрагированную нуклеиновую кислоту элюировали в 100 мкл буфера для элюции и хранили при -80°C для тестирования количественной ПЦР.

Образец мокроты смешивали с 1 мл фосфатно-солевого буфера (PBS), гомогенизировали пипетированием и встряхиванием, смешивали с 12.5 мМ равных объемов свежеприготовленного дитиотреитола (DTT, формат No Weigh™, Fisher Scientific) и инкубировали при комнатной температуре в течение 30 минут с периодическим встряхиванием. Полученный раствор разделяли на аликвоты по 400 мкл и хранили при -80°С. Затем аликвоту обработанного образца объемом 400 мкл экстрагировали на приборе MagNA Pure Compact и хранили, как описано выше.

Экстрагированная нуклеиновая кислота была протестирована на
P. aeruginosa ,
S. aureus ,
К. pneumoniae и
С.mitis с помощью индивидуальных ПЦР в реальном времени. Последовательности праймеров и зондов для этих анализов были описаны ранее.
25 . То
Праймеры S. mitis : прямой TTTTGTCATCTAGCCTTGC; Обратный GCAGTCATATCATCACCTTC и зонд ACTTGGGCAATCCCGACAGATTCTAAC с 5′-репортером FAM и 3′-гасителем BHQ. Реакции ПЦР проводили с использованием 5 мкл выделенной из образцов нуклеиновой кислоты и 12,5 мкл PerfeCTa Multiplex qPCR SuperMix (каталожный номер

-200; Quanta BioSciences), 0.Конечные концентрации каждого праймера 5 мкМ, конечная концентрация зонда 0,1 мкМ и вода без нуклеаз (номер по каталогу P1193; Promega) до конечного реакционного объема 25 мкл. Реакции ПЦР в реальном времени проводили с использованием стандартной машины ABI 7500 (Life Technologies, Карлсбад, Калифорния) с активацией фермента при 95°C в течение 5 минут, с последующими 45 циклами при 95°C в течение 15 секунд и 60°C в течение 1 минуты. . Все образцы от пациентов с муковисцидозом анализировали в двух повторах для каждой мишени. То
С
T
Значения для отдельных анализов ПЦР использовались как показатель относительного количества бактерий в образце.

Результаты

Все испытуемые благополучно завершили сбор образцов. В качестве контроля использовали десять здоровых испытуемых. Образцы мокроты и кашля были успешно собраны у 20 взрослых пациентов с муковисцидозом, за исключением пяти пациентов, которые не смогли получить образец мокроты.

Нормальные контроли продемонстрировали высокую частоту ложноположительных результатов при пероральном отборе проб, как показано на рис.
. Бактерии были выделены из мазков из зева у 4/10 (40%) нормальных здоровых субъектов контрольной группы.
С.pneumoniae был положительным в 2/10 (20%) пероральных образцах и
S. aureus был положительным в 3/10 (30%) пероральных образцах, при этом у одного субъекта были обнаружены обе бактерии. Напротив, 0/10 (0%, p = 0,0313) образцов от кашля были положительными на наличие бактерий в контрольной группе. Рассчитанная доля истинных отрицательных результатов или специфичность для образцов мокроты составила 60% и 100% для образцов от кашля.

Таблица 1.

Обнаружение бактерий в образцах из горла и при кашле у нормальных здоровых людей.

5 2

5 отрицательный

5 3

5 4

5 6

5 7

5 8

5 отрицательный

5

5 отрицательный

5 отрицательный

5 10

Горло Кашель
1 S. aureus отрицательный
отрицательный
отрицательный отрицательный
4 S. aureus Отрицательный
5 S. aureus ,
S.pneumoniae
отрицательный
отрицательный отрицательный
отрицательный отрицательный
8 С.пневмонии
Отрицательный Отрицательный

Специфика в CF пациентам было похоже. Для пациентов с муковисцидозом
S. mitis был выделен из 13/14 (93%) образцов мокроты, но ни в одном из образцов кашля (0%, p = 0,0002). Образцы от кашля, собранные не
S. mitis . CFRB был собран в образцах обоих типов. P. aeruginosa был выделен из 13/15 (87%) образцов мокроты и 9/20 (45%) образцов кашля (р=0,0213).
S. aureus был выделен из 9/15 (60%) образцов мокроты и 3/20 (15%) образцов кашля.
K. pneumoniae был выделен из 2/15 (13%) образцов мокроты и 3/20 (15%) образцов кашля.

В совокупности образцы мокроты были положительными на CFRB в 15/15 (100%) образцах. Образцы кашля были положительными на CFRB в 13/20 (65%) образцах. Образцы мокроты содержали 93% оральных комменсалов.Образцы мокроты были положительными в отношении трех и более возбудителей в 2/15 (13%) образцов и положительных в отношении двух и более возбудителей в 7/15 (47%) образцов. Напротив, образцы от кашля не имели комменсалов и были положительными у 65% пациентов с муковисцидозом. Образцы кашля были положительными на два или более возбудителей в 2/20 (10%, p<0,05) образцах, и ни один образец кашля не был положительным на три или более возбудителей. Результаты этих идентификаций ПЦР в реальном времени перечислены в .

Таблица 2.

Обнаружение бактерий в образцах мокроты и кашля взрослых пациентов с муковисцидозом.

5

5
2+ возбудителя

Мокрота Кашель
n=15* %

С
Т


диапазон
n=20 % С
Т


диапазон
P. aeruginosa 13/15 87% 18–33 2/20 45% 33–42
С.золотистый 9/15 60% 24–38 3/20 15% 36–40
К.пневмония 2/15 13% 37–38 3/20 15% 39–43
CFRB всего 15/15 100 % 18–38 13/20 65 % 33–43
7/15 47% 18–38 2/20 10% 36–43
3+ возбудителя 2/15 13% 18–38 0/20 0% Н/Д
С.митис 13/14† 93% 24–41 0/17§ 0% Н/Д

С
T
значения обратно пропорциональны количеству бактерий в образце, т. е. малые значения указывают на большее количество колониеобразующих единиц (КОЕ). Для образцов CFRB,
P. aeruginosa С
T
значения варьировались от 18–33 в образцах мокроты и 33–42 в образцах кашля.
S. aureus C
T
значения варьировались от 24–38 в образцах мокроты и 36–40 в образцах кашля.Для обоих
P. aeruginosa и
S. aureus образцы кашля и мокроты значительно различались по
С
T
значений (p=0,0017 и 0,0092 соответственно).
К. пневмонии C
T
значения варьировались от 37–38 в образцах мокроты и 39–43 в образцах кашля. Таким образом
С
T
значения для образцов кашля были постоянно выше, чем для мокроты. Обратите внимание, что образцы кашлевого фильтра от нормальных контролей не обнаруживали патогенов вплоть до
С
T
значений 60.

Обсуждение

Общепризнанно, что для сбора патогенов нижних дыхательных путей необходим простой, безопасный, неинвазивный, не требующий особого ухода, недорогой, широко доступный пробоотборник.
34–
37
.

Сбор содержимого нижних отделов легких при кашле намного проще, чем сбор образцов БАЛ. Метод удобен для пациентов, которые уже склонны к кашлю и сообщают, что использование аппарата помогло очистить легкие. Образцы кашля могут служить неинвазивным, но специфическим образцом для наблюдения на дому с целью наблюдения за всплесками легочных патогенов у пациентов с муковисцидозом.Использование устройства для сбора аэрозолей от кашля потенциально может стать чистой альтернативой пероральным образцам для обнаружения патогенов нижних отделов легких.

Как известно, обычно используемые образцы мокроты или мазков из ОП показывают сильное загрязнение верхних дыхательных путей
3,
4
. Почти все образцы мокроты были положительными на оральные комменсалы.
S. mitis . Напротив, ни один из образцов кашля не был положительным на
S. mitis . Это различие в комменсалах
С.mitis между образцами мокроты и кашля подтверждает ненадежность и низкую специфичность мокроты.
3,
4
. Кроме того, не все пациенты могут получить адекватный образец мокроты. Обследование 12 субъектов с парной мокротой и
Результаты S. mitis , 8/12 (67%) образцов мокроты и кашля дали согласующиеся положительные результаты, хотя шесть из этих восьми были положительными на наличие дополнительных бактерий в мокроте. Эти шесть образцов мокроты с множественными бактериями, вероятно, указывают на ложноположительные результаты от перорального загрязнения, а не от коинфекции.

Количество конкордантных образцов мокроты и кашля (2/12, 17%) было небольшим. И наоборот, патоген, обнаруженный в образце кашля, отличался от наблюдаемого в образце мокроты. В 2/12 (17%) образцах мокроты не были идентифицированы бактерии, которые были идентифицированы в образцах кашля, что, возможно, отражает маскированные показания, связанные с комменсальным отвлечением. Различия демонстрируют, что устройство от кашля не просто собирает мокроту.

P. aeruginosa — наиболее распространенная бактерия, обнаруживаемая в легких взрослых пациентов с муковисцидозом.
19 , а также была самой распространенной бактерией, собранной в нашей когорте.13/20 (65%) образцов кашля были положительными на CFRB. Эта заболеваемость и распределение патогенов при муковисцидозе аналогичны 59% положительных результатов на CFRB в пробах БАЛ.
22, г.
23
. Предыдущие серии образцов БАЛ в аналогичных популяциях дали положительный CFRB 59–85%, что аналогично 65% положительности от устройства для кашля, иллюстрирующего сопоставимую чувствительность.
22, г.
23
.

Сбор выдыхаемых аэрозолей изучался несколькими предыдущими группами. Альтернативным устройством для сбора аэрозолей является RTube™; однако он сильно различается по дизайну и функциям
28 .Система RTube™ предназначена для сбора всего выдыхаемого воздуха, который конденсируется.
28 , в то время как PneumoniaCheck™ предназначен для сбора аэрозолей в легких размером с частицы и отделения содержимого рта
16 . Большая часть выдыхаемого газа выходит из конца RTtube™, так как предназначен только для сбора водяного конденсата. Конденсат выдыхаемого воздуха может быть полезным образцом для определения уровня pH, но, как правило, не считается надежным образцом для выявления инфекций нижних дыхательных путей.
34–
37
.

Уэйнрайт
и др. ., сообщили об обнаружении
P. aeruginosa в аэрозолях от кашля по культуре
12 . Они сообщили о 25 из 28 (89%) положительных результатов в смешанной популяции детей и взрослых с муковисцидозом с использованием системы отбора проб аэрозолей от кашля (CASS) в течение 5 минут с каждым субъектом.
12 . Аналогично, Ниббс
и др. сообщили, что 14 из 18 (78%) пациентов подверглись аэрозольной
P. aeruginosa , которые оставались жизнеспособными и предположительно трансмиссивными в течение 45 минут после кашля, взятого с помощью импактора Андерсона.
13 .Ниббс
и др. . использовали обычные микробиологические культуры для количественного определения колониеобразующих единиц. В обоих этих исследованиях использовался специально сконструированный пробоотборник аэрозолей, который является дорогим, громоздким и сложным для использования в клинических условиях. Для этих исследований пациенты кашляют в стандартный мундштук, а аэрозоли всасываются в импакторы с помощью вакуумных воздушных насосов. Система CASS не предназначена для рутинного использования в клинических условиях, а мундштук не предназначен для исключения содержимого полости рта. Эти конструкции отличаются от PneumoniaCheck™, который имеет мундштук, специально предназначенный для исключения загрязнения ротовой полости.
16 .Высокая заболеваемость
P. aeruginosa при использовании мундштука и трубки типа трубки может отражать некоторый сбор содержимого полости рта с помощью CASS.

ОТ-ПЦР можно использовать для количественного определения количества патогенов в образце. Чем больше материала собирается на фильтре, тем
С
T
количество отсчетов упадет подобно обратному значению КОЕ
32 . Следует отметить, что аэрозольный образец легкого должен иметь более высокую
С
T
значений по сравнению с жидкими образцами мокроты из-за отсутствия контаминации и небольшого физического объема аэрозолей. С
T
значения в образцах мокроты колебались от 19 до 38, а в образцах от кашля – от 33 до 43 (p<0,001, ). Тем не менее, С
T
значения во всех положительных образцах от кашля значительно ниже исходного уровня >60 для нормального контроля. В то время как
С
T
значения выше для образцов от кашля, уровень фонового шума первичного фильтра >60, что допускает пределы обнаружения методом ПЦР, который может быть более чувствительным к CFRB легких.

Таблица 3.


С
T
значения образцов мокроты и кашля, сгруппированные по возбудителям.

2

5 N / A

5 N / A

5 N / A

5 6 9 0023

7

70023

9005 N / A

N / A

5 –

5 10

5 N / A

5 38

5 –

5 29

5 –

Субъект P. aeruginosa S. aureus К. пневмонии С. mitis
# Мокрота Кашля Мокроты Кашля Мокроты Кашель Мокроты Кашель
1 22 33 41
N / A 42 N / A
3 32 32
4 21 41 36 24
5 N / A N / A N / A
18 41 32
N / A N / A
N / A 35 N / A N / A
9 N / A N / A N / A N / A N / A 43 31
19 38 40 37 37 N / A
11 19 42 27 N / A N / A
12 20 30
13 33 39 30 33
14 33 40 24 33
15 37 32
16 25 31
17 33 39 27
25
19 25 39 29 39 29
20 22 42 34 Н/Д

Можно использовать
С
T
значений для сравнения относительного количества патогенов, выделяемых при кашле у отдельного пациента, по сравнению с популяцией
32, г.
33
.Джонс-Лопес
и др. обнаружили, что как больные муковисцидозом, так и больные туберкулезом могут образовывать аэрозоли с жизнеспособными патогенами, но количество патогенов, вырабатываемых отдельными людьми, сильно различается.
31 . Пациенты с большим количеством
M. tuberculosis в аэрозолях от кашля с большей вероятностью передавались другим
30 . Те, которые производят большое количество патогенов при кашле, могут быть более эффективными переносчиками, например. «суперраспределители»
13, г.
30
. Количество патогенов в кашле может быть критическим показателем передачи инфекционных заболеваний, борьбы с эпидемиями и мониторинга колонизации.В Джонс-Лопес
и др. . исследование, количество аэрозольных
M.tuberculosis резко снизилась после трех недель лечения. Таким образом, образец кашля также можно использовать для мониторинга уровня резистентных бактерий, если они присутствуют.

В опубликованных руководствах для пациентов с муковисцидозом предлагается ежеквартально собирать образцы из дыхательных путей для мониторинга легочных инфекций
26, г.
27
. Образцы кашля могут быть более специфичным и чувствительным методом мониторинга колонизации и определения инфекционности.Дополнительные исследования могут дополнительно изучить это приложение путем сравнения
С
T
значений с симптомами. Если за пациентом с муковисцидозом регулярно наблюдают, используя образцы от кашля, внезапное снижение
С
T Значение
может указывать на изменение бремени патогенов
32, г.
33
. То
С
T
Величина содержания патогенов в аэрозолях от кашля может быть полезной в качестве меры для определения того, растет ли количество возбудителей в легких.

Это исследование имеет несколько ограничений.В наше исследование были включены только взрослые пациенты; таким образом, мы не можем комментировать образование аэрозоля при кашле у детей. В этом исследовании сообщается о 20 пациентах. В большинстве исследований, опубликованных в литературе, задействовано одинаковое количество субъектов, поскольку идентификация нижних дыхательных путей всегда была огромной проблемой.
12, г.
13
. Будущие исследования могут оценить преимущества необходимости большего количества кашля или кашля в течение определенного периода времени, например 5 минут, для установления
С
T
пороговые значения для этого нового метода сбора образцов.Молекулярные анализы RT-PCR, использованные в этом исследовании, доступны не во всех больницах, хотя несколько коммерческих лабораторий могут предоставлять услуги по клинической респираторной идентификации.

Заключение

Таким образом, мы показали, что новое устройство может собирать легочные патогены взрослых пациентов с муковисцидозом из аэрозолей от кашля с идентификацией с помощью молекулярного анализа. Устройство исключает загрязнения полости рта, показывая более высокую специфичность, чем образцы мокроты. Выявление возбудителей в нижних дыхательных путях, вероятно, сыграет важную роль в лечении пациентов.
24 .Данные этого исследования предлагают альтернативу сбору мокроты для идентификации возбудителей нижних дыхательных путей.

Согласие

Письменное информированное согласие было получено всеми участниками в соответствии с протоколом Институционального наблюдательного совета № 000-2492, утвержденным Технологическим институтом Джорджии, Университетом Эмори и Центрами США по контролю и профилактике заболеваний.

Доступность данных

Данные, на которые ссылается эта статья, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Примечания

[версия 1; рефери: одобрено 2]

Заявление о финансировании

При поддержке внутренних грантов Центров США по контролю и профилактике заболеваний и Университетской больницы Эмори.

Спонсоры не участвовали в разработке дизайна исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Каталожные номера

1.
Бернс МВт:
Преципитины к клебсиеллам и другим энтеробактериям в сыворотке крови больных хроническими респираторными заболеваниями. Ланцет.
1968; 1 (7539): 383–385.
10.1016/С0140-6736(68)-6
[PubMed] [CrossRef] [Google Scholar]2.
Годдард А.Ф., Штаудингер Б.Дж., Дауд С.Е. и др. :
Прямые пробы легких при муковисцидозе указывают на то, что анализы образцов верхних дыхательных путей на основе ДНК могут искажать микробиоту легких.
Proc Natl Acad Sci U S A.
2012;109(34):13769–13774.
10.1073/пнас.1107435109

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3.
Лентино-младший, Лакс Д.А.:
Неценность посева мокроты при лечении инфекций нижних дыхательных путей. J Clin Microbiol.
1987; 25(5):758–762.

[Бесплатная статья PMC] [PubMed] [Google Scholar]4.
Розенфельд М., Эмерсон Дж., Аккурсо Ф. и др. :
Диагностическая точность культур из ротоглотки у младенцев и детей раннего возраста с муковисцидозом.
Педиатр Пульмонол.
1999;28(5):321–328.
10.1002/(SICI)1099-0496(199911)28:5<321::AID-PPUL3>3.0.CO;2-V
[PubMed] [CrossRef] [Google Scholar]5.
Гилкрист Ф.Дж., Саламат С., Клейтон С. и др. :
Бронхоальвеолярный лаваж у детей с муковисцидозом: сколько долей следует брать?
Арч Ди Чайлд.
2011;96:215–217.
10.1136/доп.2009.177618
[PubMed] [CrossRef] [Google Scholar]6.
Уилнер Д., Хейнс М.Р., Фурлан М. и др. :
Пространственное распределение микробных сообществ в легком при муковисцидозе.
ИСМЕ Дж.
2012;6(2):471–474.
10.1038/исмей.2011.104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7.
Уимберли Н., Фалинг Л.Дж., Бартлетт Дж.Г.:
Метод фиброоптической бронхоскопии для получения незагрязненных выделений из нижних дыхательных путей для бактериального посева.
Am Rev Respir Dis.
1979;119(3):337–343.
[PubMed] [Google Scholar]8.
Коуч Р.Б., Кейт Т.Р., Дуглас Р.Г.-младший и др. :
Влияние пути прививки на экспериментальное респираторное вирусное заболевание у добровольцев и доказательства воздушно-капельной передачи.
Бактериол Ред.
1966; 30 (3): 517–529.

[Бесплатная статья PMC] [PubMed] [Google Scholar]9.
Коуч Р.Б., Кейт Т.Р., Героне П.Дж. и др. :
Появление болезни с помощью мелкодисперсного аэрозоля Коксаки А
21 .
Дж Клин Инвест.
1965; 44 (4): 535–542.10.1172/ДЖКИ105166

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10.
Gerone PJ, Couch RB, Keefer GV и др. :
Оценка экспериментальных и природных вирусных аэрозолей.
Бактериол Ред.
1966; 30 (3): 576–584.

[Бесплатная статья PMC] [PubMed] [Google Scholar]11.
Ли Н., Чан П.К., Хуэй Д.С. и др. :
Вирусная нагрузка и продолжительность выделения вируса у взрослых пациентов, госпитализированных с гриппом.
J Заразить Dis.
2009;200(4):492–500.
10.1086/600383
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12.Уэйнрайт К.Э., Франция М.В., О’Рурк П. и др. :
Аэрозоли, вызываемые кашлем
Pseudomonas aeruginosa и другие грамотрицательные бактерии от пациентов с муковисцидозом.
Грудная клетка.
2009;64(11):926–931.
10.1136/thx.2008.112466

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13.
Ниббс Л.Д., Джонсон Г.Р., Кидд Т.Дж. и др. :
Жизнеспособность
Pseudomonas aeruginosa в аэрозолях от кашля, выделяемых людьми с муковисцидозом.
Грудная клетка.
2014;69(8):740–745.10.1136/thoraxjnl-2014-205213

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14.
Лильемарк В.Ф., Гиббонс Р.Дж.:
Пропорциональное распределение и относительная адгезия стрептококковых клещей (
mitis ) на различных поверхностях ротовой полости человека.
Заразить иммунн.
1972; 6 (5): 852–859.

[Бесплатная статья PMC] [PubMed] [Google Scholar]15.
Hart MC, Orzalesi MM, Cook CD:
Связь между анатомическим мертвым пространством дыхательных путей, размерами тела и объемом легких.
J Appl Physiol.
1963; 18 (3): 519–522.Справочный источник
[Google Академия] 16.
Scholz TL, Midha PA, Anderson LJ, et al. :
PneumoniaCheck: устройство для отбора проб аэрозолей из нижних дыхательных путей.
J Med Devices.
2010;4(4):041005
10.1115/1.4002760
[Перекрестная ссылка] [Академия Google] 17.
Реестр пациентов Фонда кистозного фиброза: Ежегодный отчет о данных за 2013 г. для директоров Центра. Бетесда, Мэриленд. 2014 г. [Google Академия] 18.
Фернесс Дж. К., Хабеб А., Спенсер Д. А. и соавт. :
В редакцию: Бронхоальвеолярный лаваж (БАЛ) при педиатрическом муковисцидозе (МВ): его клиническое применение, модифицированное аудитом в региональном центре МВ. Педиатр Пульмонол.
2002;33(3):234.
10.1002/стр.10052
[PubMed] [CrossRef] [Google Scholar] 20.
Рэмси Б.В., Венц К.Р., Смит А.Л. и соавт. :
Прогностическая ценность культур ротоглотки для выявления бактерий нижних дыхательных путей у пациентов с муковисцидозом.
Am Rev Respir Dis.
1991;144(2):331–337.
10.1164/ajrccm/144.2.331
[PubMed] [CrossRef] [Google Scholar] 21.
Армстронг Д.С., Гримвуд К., Карлин Дж.Б. и др. :
Бронхоальвеолярный лаваж или посев из ротоглотки для выявления патогенов нижних дыхательных путей у младенцев с муковисцидозом. Педиатр Пульмонол.
1996;21(5):267–275.
10.1002/(SICI)1099-0496(199605)21:5<267::AID-PPUL1>3.0.CO;2-K
[PubMed] [CrossRef] [Google Scholar] 22.
Harris JK, De Groote MA, Sagel SD, et al. :
Молекулярная идентификация бактерий в жидкости бронхоальвеолярного лаважа у детей с муковисцидозом.
Proc Natl Acad Sci U S A.
2007;104(51):20529–20533.
10.1073/пнас.0709804104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]23.
Zemanick ET, Wagner BD, Harris JK, et al.:
Легочные обострения при муковисцидозе с отрицательными бактериальными культурами.
Педиатр Пульмонол.
2010;45(6):569–577.
10.1002/стр.21221

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]24.
Oosterheert JJ, Bonten MJ, Buskens E, et al. :
Алгоритм определения экономии затрат на таргетную антимикробную терапию по результатам экспресс-диагностики.
J Clin Microbiol.
2003;41(10):4708–4713.
10.1128/JCM.41.10.4708-4713.2003

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25.Эмери С.Л., Эрдман Д.Д., Боуэн М.Д. и соавт. :
Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для коронавируса, связанного с SARS.
Emer Infect Dis.
2004;10(2):311–316.
10.3201/eid1002.030759

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]26.
Сайман Л., Сигел Дж.,
Фонд муковисцидоза:
Рекомендации по инфекционному контролю для пациентов с муковисцидозом: микробиология, важные патогены и методы инфекционного контроля для предотвращения передачи инфекции от пациента к пациенту. Infect Control Hosp Epidemiol.
2003; 24 (5 Дополнение): S6–52.
10.1086/503485
[PubMed] [CrossRef] [Google Scholar] 27.
Yankaskas JR, Marshall BC, Sufian B, et al. :
Уход за взрослыми при муковисцидозе: консенсусный отчет конференции.
Сундук.
2004; 125 (1 Приложение): 1С–39С.
10.1378/грудь.125.1_доп.1С
[PubMed] [CrossRef] [Google Scholar] 28.
Сойер О.У., Диздар Э.А., Кескин О. и соавт. :
Сравнение двух методов сбора конденсата выдыхаемого воздуха.
Аллергия.
2006;61(8):1016–1018.
10.1111/j.1398-9995.2006.01064.x
[PubMed] [CrossRef] [Google Scholar] 29.
Феннелли К.П., Мартини Дж.В., Фултон К.Е. и др. :
Аэрозоли, вызываемые кашлем
Mycobacterium tuberculosis : новый метод изучения инфекционности.
Am J Respir Crit Care Med.
2004;169(5):604–609.
10.1164/rccm.200308-1101OC
[PubMed] [CrossRef] [Google Scholar] 30.
Феннелли К.П., Джонс-Лопес Э.К., Аякака И. и др. :
Изменчивость инфекционных аэрозолей, образующихся при кашле у больных туберкулезом легких. Am J Respir Crit Care Med.
2012;186(5):450–457.
10.1164/rccm.201203-0444OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]31.
Джонс-Лопес Э.К., Намугга О., Мамбова Ф. и др. :
аэрозоли от кашля
Mycobacterium tuberculosis предсказывают новую инфекцию: исследование бытовых контактов.
Am J Respir Crit Care Med.
2013;187(9):1007–1015.
10.1164/rccm.201208-1422OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]32.
Мехта Т., МакГрат Э., Бхимредди С. и др.:
Обнаружение устойчивости к осельтамивиру во время лечения инфекции вируса гриппа h2N1 2009 у пациентов с ослабленным иммунитетом: полезность пороговых значений цикла качественной ПЦР с обратной транскриптазой в реальном времени.
J Clin Microbiol.
2010;48(11):4326–4328.
10.1128/JCM.01190-10

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]33.
Эспи М.Дж., Уль Дж.Р., Слоан Л.М. и др. :
ПЦР в реальном времени в клинической микробиологии: приложения для рутинных лабораторных испытаний.
Clin Microbiol, версия
2006;19(1):165–256.10.1128/CMR.19.1.165-256.2006

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]34.
Xu Z, Shen F, Li X и др. :
Молекулярный и микроскопический анализ бактерий и вирусов в выдыхаемом воздухе, собранном с помощью простого метода импакции и конденсации.
PLoS Один.
2012;7(7):e41137.
10.1371/journal.pone.0041137

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]35.
Хауспи Л., Де Костер С., Кейартс Э. и др. :
Отбор проб конденсата выдыхаемого воздуха не является новым методом обнаружения респираторных вирусов. Вирол Дж.
2011;8:98.
10.1186/1743-422Х-8-98

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]36.
Фабиан П., Макдевитт Дж. Дж., ДеХаан В. Х. и др. :
Вирус гриппа в выдыхаемом воздухе человека: обсервационное исследование.
PLoS Один.
2008;3(7):e2691.
10.1371/journal.pone.0002691

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]37.
Huynh KN, Oliver BG, Stelzer S, et al. :
Новый метод отбора проб и обнаружения аэрозолей респираторных вирусов в выдыхаемом воздухе.
Clin Infect Dis.
2008;46(1):93–95.
10.1086/523000
[PubMed] [CrossRef] [Google Scholar]

Способность устройства собирать бактерии из аэрозолей от кашля, выделяемых взрослыми с муковисцидозом

Версия 1. F1000Res. 2016; 5: 1920.

, A, 1, 2 , 2 , 3, 4 , 3, 4 , 5 , 5 и 6

Дэвид Н. Ку

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

Сара К.Ку

2 MD Innovate, Inc., Декейтер, Джорджия, 30030, США

Бет Хелфман

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Наэль А. Маккарти

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

Бернард Дж.Вольф

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Джонас М. Винчелл

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

Ларри Дж. Андерсон

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

1 Технологический институт Джорджии, Атланта, Джорджия, 30332, США

2 MD Innovate, Inc, Декейтер, Джорджия, 30030, США

3 Детский центр исследований муковисцидоза Эмори, Университет Эмори, Атланта, Джорджия, 30322, США

4 Кафедра педиатрии, Университет Эмори, Атланта, 30322, США

5 Отделение респираторных заболеваний, Центры по контролю и профилактике заболеваний, Атланта, Джорджия, 30333, США

6 Отделение инфекционных заболеваний, кафедра педиатрии, Университет Эмори и Детское здравоохранение Атланты, Атланта, Джорджия, 30322, США

Дэвид Н.Ку, Наэль А. Маккарти, Бернард Дж. Вольф, Джонас М. Винчелл и Ларри Дж. Андерсон были научными консультантами. Бет Хелфман собирала данные, предоставляла и ухаживала за пациентами исследования. Сара К. Ку написала и отредактировала большую часть рукописи. Все авторы согласились с окончательным содержанием статьи.

Конкурирующие интересы: Д-р Дэвид Н. Ку, Сара К. Ку и д-р Ларри Дж. Андерсон являются соавторами патента PneumoniaCheck™, лицензированного MD Innovate, Inc. из Центров по контролю и профилактике заболеваний США и Джорджии. Корпорация технических исследований.

Эта статья находится в открытом доступе и распространяется в соответствии с лицензией Creative Commons Attribution, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.

Эта статья была процитирована другими статьями в PMC.

Заявление о доступности данных

Данные, упомянутые в этой статье, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Аннотация

Исходная информация : Идентификация легочных патогенов и резких всплесков легочных показателей остается проблемой при лечении пациентов с кистозным фиброзом (МВ). Бактерии из глубоких отделов легких можно брать из аэрозолей, образующихся при кашле.

Методы : Новое устройство было использовано для сбора и измерения уровня бактерий в аэрозолях от кашля у пациентов с муковисцидозом. Образцы мокроты и полости рта также были собраны и измерены для сравнения. синегнойная палочка ,
Золотистый стафилококк ,
Klebsiella pneumoniae и
Streptococcus mitis были обнаружены в образцах с помощью молекулярных анализов полимеразной цепной реакции в реальном времени (RT-PCR).

Результаты : В исследовании приняли участие 20 взрослых пациентов с муковисцидозом и 10 здоровых людей из контрольной группы. Бактерии, связанные с CF (CFRB), были обнаружены в 13/20 (65%) образцах кашля по сравнению с 15/15 (100%) образцах мокроты. Комменсал
S. mitis присутствовал у 0/17 (0%, р=0.0002) образцы кашля и 13/14 (93%) образцов мокроты. В нормальных контрольных образцах в образцах от кашля не было собрано никаких бактерий, но 4/10 (40%) образцов из полости рта были положительными на CFRB.

Выводы : Неинвазивный сбор аэрозолей от кашля может обнаруживать патогены нижних дыхательных путей у пациентов с муковисцидозом с такой же специфичностью и чувствительностью, что и показатели, определяемые БАЛ, без контаминации пероральными CFRB или комменсальными бактериями.

Ключевые слова: Муковисцидоз, аэрозоли, сбор образцов, респираторные инфекции, этиология

Введение

Этиологию инфекций нижних дыхательных путей в легких трудно определить, отчасти потому, инфекция недоступна
1–
4
.Доступ к такому образцу был бы важным шагом вперед в мониторинге и лечении муковисцидоза (МВ), а также других инфекций нижних дыхательных путей, таких как пневмония, туберкулез, астма, рак легких и т. д. В настоящее время ротоглоточный (ОП) , мокрота и образцы бронхоальвеолярного лаважа (БАЛ) обычно используются для наблюдения за пациентами с муковисцидозом. Образцы OP могут подходить для обнаружения вирусов, но не идеальны для большинства бактериальных патогенов. Мокрота обычно собирается для мониторинга муковисцидоза, но часто содержит загрязнители и бактерии, связанные с муковисцидозом (CFRB) из верхних дыхательных путей.Трудности, с которыми сталкиваются некоторые пациенты при получении приемлемого образца мокроты, еще больше снижают ценность этих образцов, часто заставляя врача лечить пациента эмпирическим путем.
1–
4
. БАЛ дает образец из легких, но это инвазивная процедура, которую нельзя использовать в обычном порядке. Образцы БАЛ могут также собирать загрязняющие вещества из верхних дыхательных путей.
5–
7
.

Альтернативным источником образцов легких являются аэрозоли, образующиеся при кашле
8–
12
.Исследования показывают, что один кашель может генерировать до 66 000 выбрасываемых частиц.
10,
13
. Пациенты с инфекциями нижних дыхательных путей могут заражать других через респираторное распространение возбудителей в аэрозолях, образующихся при кашле или чихании. Кашель вызывает более высокую концентрацию патогенов из нижних отделов легких, чем обычный выдох или чихание.
8–
13
. Новое устройство для сбора образцов от кашля (PneumoniaCheck™,
) собирает аэрозоли из легких на фильтр с микропорами, сводя к минимуму загрязнение верхних дыхательных путей.Затем можно использовать микробиологические или молекулярные анализы для обнаружения патогенов, собранных на фильтре устройства.

Контейнер для хранения и транспортировки образцов PneumoniaCheck™.

В устройстве используется резервуар для отделения содержимого полости рта от аэрозолей глубоко в легких с использованием гидромеханики для разделения (
). Первоначальный объем воздуха, который поступает при выдохе или кашле, представляет собой загрязненный воздух из верхних дыхательных путей, также известный как анатомическое мертвое пространство. Когда пациент кашляет в аппарат, этот воздух из верхних дыхательных путей сначала попадает в резервуар (
).Выдыхаемый воздух сначала поступает в резервуар, так как он имеет наименьшее сопротивление по сравнению с фильтром на конце устройства. Этот резервуар имеет объем 250 мл, что примерно на 100 мл больше, чем объем анатомического мертвого пространства у среднего взрослого человека.
15 , что гарантирует полное отделение всех аэрозолей верхних дыхательных путей. Расширенный резервуар неэластичен, создавая противодавление, поэтому последующий выдыхаемый воздух принудительно проходит через микробный фильтр (
). Таким образом, на фильтр собирается только легочное аэрозольное содержимое, не загрязняющее верхние дыхательные пути.

Гидромеханическое разделение дыхательных путей PneumoniaCheck™.

(
a ) Загрязненные частицы верхних дыхательных путей изо рта сначала заполняют воздушный резервуар. (
b ) Затем незагрязненные частицы нижних дыхательных путей из легких улавливаются фильтром.

Предыдущее исследование показало, что фильтр устройства более чем на 99 % эффективен для сбора переносимых по воздуху бактерий (диаметром приблизительно 3,1 мкм) и вирусов (диаметром приблизительно 2,8 мкм).
16 .Отбор проб из контрольной группы здоровых людей показал нулевое скопление содержимого ротовой полости на фильтре, даже при наличии во рту до 15 мл жидкости (имитирующей мокроту). Было показано, что устройство PneumoniaCheck™ значительно отделяет газ в нижних дыхательных путях от газа в верхних дыхательных путях в зависимости от уровня кислорода и алкоголя (p<0,0001). 16 .

МВ — это генетическое заболевание, которое ежегодно поражает легкие примерно 28 000 детей и взрослых в США.
17 . Люди с муковисцидозом часто имеют хронические инфекции легких и нуждаются в регулярном наблюдении, чтобы гарантировать, что бактериальная колонизация не перерастет в инфекцию.
26, г.
27
.Мы использовали образцы мокроты и кашля, чтобы сравнить их способность улавливать, идентифицировать и количественно определять относительные уровни легочных бактерий у взрослых пациентов с муковисцидозом. Цель этого исследования — определить, может ли устройство от кашля улавливать легочные патогены взрослых пациентов с хронической легочной инфекцией, одновременно исключая оральные бактерии.

Материалы и методы

Субъекты

Пациенты с муковисцидозом (n=20) в возрасте старше 18 лет были набраны из клиники для взрослых Центра кистозного фиброза Эмори в Атланте, Джорджия.Институциональный наблюдательный совет Эмори ({“type”:”entrez-нуклеотид”,”attrs”:{“text”:”H08353″,”term_id”:”873175″,”term_text”:”H08353″}}H08353) одобрил исследование и участники предоставили письменное информированное согласие. Размер выборки был достаточно мощным, чтобы продемонстрировать статистическую значимость отбора проб нижних отделов легких без орального загрязнения. Тесты парных пропорций проводились с использованием точной формы теста Макнемара для сравнения наличия CFRB между двумя образцами (т.е. кашель и мокрота).Критерий знакового ранга Уилкоксона использовался для сравнения порога цикла (
С
T
) значения между различными методами выборки. То
С
T
Значение 60 использовалось в качестве верхнего предела обнаружения для всех анализов ПЦР для определения относительного количества бактерий в каждом образце.

Клинические измерения

Образцы мазков из горла и устройства от кашля были взяты у 10 здоровых некурящих субъектов для нормального контроля. Отдельно у 20 взрослых пациентов с муковисцидозом были взяты образцы мокроты и средства от кашля.Сбор образцов устройства для кашля предшествовал сбору образцов мокроты, чтобы помочь вызвать мокроту. Сбор образцов находился под наблюдением, и аварийное оборудование было легко доступно.
Streptococcus mitis — это комменсальная бактерия, которая обнаруживается во рту, но не в легких.
14 .
Streptococcus pneumoniae и
Staphylococcus aureus также часто обнаруживаются в ротовой полости.
3 .
синегнойная палочка ,
Staphylococcus aureus и
Klebsiella pneumoniae являются бактериями, родственными муковисцидозу (CFRB).
18–
20
.Образцы полости рта и кашля были проанализированы на наличие этих бактерий для определения уровня загрязнения полости рта.

Определение достаточного сбора аэрозолей

Система отбора проб аэрозолей от кашля Fennelly (CASS)
29, г.
30
и дистанционная установка Knibbs
13 продемонстрировали, что частицы кашля могут нести значительные концентрации бактерий от инфекций нижних дыхательных путей. В предыдущей статье об устройстве для сбора кашля описывается способность устройства выборочно брать пробы из нижних отделов легких, исключая загрязнения полости рта.
16 .Устройство для кашля, используемое в этом исследовании, представляет собой менее громоздкий вариант по сравнению с методами Феннелли и Ниббса для сбора образцов легких. Каждый пациент кашлянул в устройство 10 раз, чтобы обеспечить достаточный сбор аэрозоля.

Микробиология

Микробиологическое культивирование имеет ряд ограничений, которые снижают эффективность и действенность экспресс-диагностики
24 . Образцы из горла, мокроты и кашля были проанализированы с использованием методов молекулярной ПЦР. Все образцы были обработаны в безопасном шкафу BSL 2.Фильтр от кашля удаляли, помещали в стерильный морозильный флакон на 2 мл и хранили при -80°С. Респираторные выделения, захваченные фильтром, удаляли путем увлажнения фильтра 1 мл буфера для лизиса (буфер для лизиса MagNA Pure LC; Roche Applied Science, Индианаполис, Индиана), встряхивания, инкубации в течение 5 минут при комнатной температуре и сбора с помощью пипетки. Жидкость, оставшуюся в фильтре, собирали, помещая фильтр в стерильную микроцентрифужную пробирку Costar SpinX с фильтром 0,45 мкм (Corning Inc., Corning, NY), центрифугированием в течение 1 мин при 10 000 об/мин и выделением с помощью пипетки. Затем оставшуюся жидкость объединяли с исходной собранной жидкостью, а затем экстрагировали 400 мкл на приборе MagNA Pure Compact Instrument (Roche Applied Science) в соответствии с инструкциями производителя. Экстрагированную нуклеиновую кислоту элюировали в 100 мкл буфера для элюции и хранили при -80°C для тестирования количественной ПЦР.

Образец мокроты смешивали с 1 мл фосфатно-солевого буфера (PBS), гомогенизировали пипетированием и встряхиванием, смешивали с 12.5 мМ равных объемов свежеприготовленного дитиотреитола (DTT, формат No Weigh™, Fisher Scientific) и инкубировали при комнатной температуре в течение 30 минут с периодическим встряхиванием. Полученный раствор разделяли на аликвоты по 400 мкл и хранили при -80°С. Затем аликвоту обработанного образца объемом 400 мкл экстрагировали на приборе MagNA Pure Compact и хранили, как описано выше.

Экстрагированная нуклеиновая кислота была протестирована на
P. aeruginosa ,
S. aureus ,
К. pneumoniae и
С.mitis с помощью индивидуальных ПЦР в реальном времени. Последовательности праймеров и зондов для этих анализов были описаны ранее.
25 . То
Праймеры S. mitis : прямой TTTTGTCATCTAGCCTTGC; Обратный GCAGTCATATCATCACCTTC и зонд ACTTGGGCAATCCCGACAGATTCTAAC с 5′-репортером FAM и 3′-гасителем BHQ. Реакции ПЦР проводили с использованием 5 мкл выделенной из образцов нуклеиновой кислоты и 12,5 мкл PerfeCTa Multiplex qPCR SuperMix (каталожный номер

-200; Quanta BioSciences), 0.Конечные концентрации каждого праймера 5 мкМ, конечная концентрация зонда 0,1 мкМ и вода без нуклеаз (номер по каталогу P1193; Promega) до конечного реакционного объема 25 мкл. Реакции ПЦР в реальном времени проводили с использованием стандартной машины ABI 7500 (Life Technologies, Карлсбад, Калифорния) с активацией фермента при 95°C в течение 5 минут, с последующими 45 циклами при 95°C в течение 15 секунд и 60°C в течение 1 минуты. . Все образцы от пациентов с муковисцидозом анализировали в двух повторах для каждой мишени. То
С
T
Значения для отдельных анализов ПЦР использовались как показатель относительного количества бактерий в образце.

Результаты

Все испытуемые благополучно завершили сбор образцов. В качестве контроля использовали десять здоровых испытуемых. Образцы мокроты и кашля были успешно собраны у 20 взрослых пациентов с муковисцидозом, за исключением пяти пациентов, которые не смогли получить образец мокроты.

Нормальные контроли продемонстрировали высокую частоту ложноположительных результатов при пероральном отборе проб, как показано на рис.
. Бактерии были выделены из мазков из зева у 4/10 (40%) нормальных здоровых субъектов контрольной группы.
С.pneumoniae был положительным в 2/10 (20%) пероральных образцах и
S. aureus был положительным в 3/10 (30%) пероральных образцах, при этом у одного субъекта были обнаружены обе бактерии. Напротив, 0/10 (0%, p = 0,0313) образцов от кашля были положительными на наличие бактерий в контрольной группе. Рассчитанная доля истинных отрицательных результатов или специфичность для образцов мокроты составила 60% и 100% для образцов от кашля.

Таблица 1.

Обнаружение бактерий в образцах из горла и при кашле у нормальных здоровых людей.

5 2

5 отрицательный

5 3

5 4

5 6

5 7

5 8

5 отрицательный

5

5 отрицательный

5 отрицательный

5 10

Горло Кашель
1 S. aureus отрицательный
отрицательный
отрицательный отрицательный
4 S. aureus Отрицательный
5 S. aureus ,
S.pneumoniae
отрицательный
отрицательный отрицательный
отрицательный отрицательный
8 С.пневмонии
Отрицательный Отрицательный

Специфика в CF пациентам было похоже. Для пациентов с муковисцидозом
S. mitis был выделен из 13/14 (93%) образцов мокроты, но ни в одном из образцов кашля (0%, p = 0,0002). Образцы от кашля, собранные не
S. mitis . CFRB был собран в образцах обоих типов. P. aeruginosa был выделен из 13/15 (87%) образцов мокроты и 9/20 (45%) образцов кашля (р=0,0213).
S. aureus был выделен из 9/15 (60%) образцов мокроты и 3/20 (15%) образцов кашля.
K. pneumoniae был выделен из 2/15 (13%) образцов мокроты и 3/20 (15%) образцов кашля.

В совокупности образцы мокроты были положительными на CFRB в 15/15 (100%) образцах. Образцы кашля были положительными на CFRB в 13/20 (65%) образцах. Образцы мокроты содержали 93% оральных комменсалов.Образцы мокроты были положительными в отношении трех и более возбудителей в 2/15 (13%) образцов и положительных в отношении двух и более возбудителей в 7/15 (47%) образцов. Напротив, образцы от кашля не имели комменсалов и были положительными у 65% пациентов с муковисцидозом. Образцы кашля были положительными на два или более возбудителей в 2/20 (10%, p<0,05) образцах, и ни один образец кашля не был положительным на три или более возбудителей. Результаты этих идентификаций ПЦР в реальном времени перечислены в .

Таблица 2.

Обнаружение бактерий в образцах мокроты и кашля взрослых пациентов с муковисцидозом.

5

5
2+ возбудителя

Мокрота Кашель
n=15* %

С
Т


диапазон
n=20 % С
Т


диапазон
P. aeruginosa 13/15 87% 18–33 2/20 45% 33–42
С.золотистый 9/15 60% 24–38 3/20 15% 36–40
К.пневмония 2/15 13% 37–38 3/20 15% 39–43
CFRB всего 15/15 100 % 18–38 13/20 65 % 33–43
7/15 47% 18–38 2/20 10% 36–43
3+ возбудителя 2/15 13% 18–38 0/20 0% Н/Д
С.митис 13/14† 93% 24–41 0/17§ 0% Н/Д

С
T
значения обратно пропорциональны количеству бактерий в образце, т. е. малые значения указывают на большее количество колониеобразующих единиц (КОЕ). Для образцов CFRB,
P. aeruginosa С
T
значения варьировались от 18–33 в образцах мокроты и 33–42 в образцах кашля.
S. aureus C
T
значения варьировались от 24–38 в образцах мокроты и 36–40 в образцах кашля.Для обоих
P. aeruginosa и
S. aureus образцы кашля и мокроты значительно различались по
С
T
значений (p=0,0017 и 0,0092 соответственно).
К. пневмонии C
T
значения варьировались от 37–38 в образцах мокроты и 39–43 в образцах кашля. Таким образом
С
T
значения для образцов кашля были постоянно выше, чем для мокроты. Обратите внимание, что образцы кашлевого фильтра от нормальных контролей не обнаруживали патогенов вплоть до
С
T
значений 60.

Обсуждение

Общепризнанно, что для сбора патогенов нижних дыхательных путей необходим простой, безопасный, неинвазивный, не требующий особого ухода, недорогой, широко доступный пробоотборник.
34–
37
.

Сбор содержимого нижних отделов легких при кашле намного проще, чем сбор образцов БАЛ. Метод удобен для пациентов, которые уже склонны к кашлю и сообщают, что использование аппарата помогло очистить легкие. Образцы кашля могут служить неинвазивным, но специфическим образцом для наблюдения на дому с целью наблюдения за всплесками легочных патогенов у пациентов с муковисцидозом.Использование устройства для сбора аэрозолей от кашля потенциально может стать чистой альтернативой пероральным образцам для обнаружения патогенов нижних отделов легких.

Как известно, обычно используемые образцы мокроты или мазков из ОП показывают сильное загрязнение верхних дыхательных путей
3,
4
. Почти все образцы мокроты были положительными на оральные комменсалы.
S. mitis . Напротив, ни один из образцов кашля не был положительным на
S. mitis . Это различие в комменсалах
С.mitis между образцами мокроты и кашля подтверждает ненадежность и низкую специфичность мокроты.
3,
4
. Кроме того, не все пациенты могут получить адекватный образец мокроты. Обследование 12 субъектов с парной мокротой и
Результаты S. mitis , 8/12 (67%) образцов мокроты и кашля дали согласующиеся положительные результаты, хотя шесть из этих восьми были положительными на наличие дополнительных бактерий в мокроте. Эти шесть образцов мокроты с множественными бактериями, вероятно, указывают на ложноположительные результаты от перорального загрязнения, а не от коинфекции.

Количество конкордантных образцов мокроты и кашля (2/12, 17%) было небольшим. И наоборот, патоген, обнаруженный в образце кашля, отличался от наблюдаемого в образце мокроты. В 2/12 (17%) образцах мокроты не были идентифицированы бактерии, которые были идентифицированы в образцах кашля, что, возможно, отражает маскированные показания, связанные с комменсальным отвлечением. Различия демонстрируют, что устройство от кашля не просто собирает мокроту.

P. aeruginosa — наиболее распространенная бактерия, обнаруживаемая в легких взрослых пациентов с муковисцидозом.
19 , а также была самой распространенной бактерией, собранной в нашей когорте.13/20 (65%) образцов кашля были положительными на CFRB. Эта заболеваемость и распределение патогенов при муковисцидозе аналогичны 59% положительных результатов на CFRB в пробах БАЛ.
22, г.
23
. Предыдущие серии образцов БАЛ в аналогичных популяциях дали положительный CFRB 59–85%, что аналогично 65% положительности от устройства для кашля, иллюстрирующего сопоставимую чувствительность.
22, г.
23
.

Сбор выдыхаемых аэрозолей изучался несколькими предыдущими группами. Альтернативным устройством для сбора аэрозолей является RTube™; однако он сильно различается по дизайну и функциям
28 .Система RTube™ предназначена для сбора всего выдыхаемого воздуха, который конденсируется.
28 , в то время как PneumoniaCheck™ предназначен для сбора аэрозолей в легких размером с частицы и отделения содержимого рта
16 . Большая часть выдыхаемого газа выходит из конца RTtube™, так как предназначен только для сбора водяного конденсата. Конденсат выдыхаемого воздуха может быть полезным образцом для определения уровня pH, но, как правило, не считается надежным образцом для выявления инфекций нижних дыхательных путей.
34–
37
.

Уэйнрайт
и др. ., сообщили об обнаружении
P. aeruginosa в аэрозолях от кашля по культуре
12 . Они сообщили о 25 из 28 (89%) положительных результатов в смешанной популяции детей и взрослых с муковисцидозом с использованием системы отбора проб аэрозолей от кашля (CASS) в течение 5 минут с каждым субъектом.
12 . Аналогично, Ниббс
и др. сообщили, что 14 из 18 (78%) пациентов подверглись аэрозольной
P. aeruginosa , которые оставались жизнеспособными и предположительно трансмиссивными в течение 45 минут после кашля, взятого с помощью импактора Андерсона.
13 .Ниббс
и др. . использовали обычные микробиологические культуры для количественного определения колониеобразующих единиц. В обоих этих исследованиях использовался специально сконструированный пробоотборник аэрозолей, который является дорогим, громоздким и сложным для использования в клинических условиях. Для этих исследований пациенты кашляют в стандартный мундштук, а аэрозоли всасываются в импакторы с помощью вакуумных воздушных насосов. Система CASS не предназначена для рутинного использования в клинических условиях, а мундштук не предназначен для исключения содержимого полости рта. Эти конструкции отличаются от PneumoniaCheck™, который имеет мундштук, специально предназначенный для исключения загрязнения ротовой полости.
16 .Высокая заболеваемость
P. aeruginosa при использовании мундштука и трубки типа трубки может отражать некоторый сбор содержимого полости рта с помощью CASS.

ОТ-ПЦР можно использовать для количественного определения количества патогенов в образце. Чем больше материала собирается на фильтре, тем
С
T
количество отсчетов упадет подобно обратному значению КОЕ
32 . Следует отметить, что аэрозольный образец легкого должен иметь более высокую
С
T
значений по сравнению с жидкими образцами мокроты из-за отсутствия контаминации и небольшого физического объема аэрозолей. С
T
значения в образцах мокроты колебались от 19 до 38, а в образцах от кашля – от 33 до 43 (p<0,001, ). Тем не менее, С
T
значения во всех положительных образцах от кашля значительно ниже исходного уровня >60 для нормального контроля. В то время как
С
T
значения выше для образцов от кашля, уровень фонового шума первичного фильтра >60, что допускает пределы обнаружения методом ПЦР, который может быть более чувствительным к CFRB легких.

Таблица 3.


С
T
значения образцов мокроты и кашля, сгруппированные по возбудителям.

2

5 N / A

5 N / A

5 N / A

5 6 9 0023

7

70023

9005 N / A

N / A

5 –

5 10

5 N / A

5 38

5 –

5 29

5 –

Субъект P. aeruginosa S. aureus К. пневмонии С. mitis
# Мокрота Кашля Мокроты Кашля Мокроты Кашель Мокроты Кашель
1 22 33 41
N / A 42 N / A
3 32 32
4 21 41 36 24
5 N / A N / A N / A
18 41 32
N / A N / A
N / A 35 N / A N / A
9 N / A N / A N / A N / A N / A 43 31
19 38 40 37 37 N / A
11 19 42 27 N / A N / A
12 20 30
13 33 39 30 33
14 33 40 24 33
15 37 32
16 25 31
17 33 39 27
25
19 25 39 29 39 29
20 22 42 34 Н/Д

Можно использовать
С
T
значений для сравнения относительного количества патогенов, выделяемых при кашле у отдельного пациента, по сравнению с популяцией
32, г.
33
.Джонс-Лопес
и др. обнаружили, что как больные муковисцидозом, так и больные туберкулезом могут образовывать аэрозоли с жизнеспособными патогенами, но количество патогенов, вырабатываемых отдельными людьми, сильно различается.
31 . Пациенты с большим количеством
M. tuberculosis в аэрозолях от кашля с большей вероятностью передавались другим
30 . Те, которые производят большое количество патогенов при кашле, могут быть более эффективными переносчиками, например. «суперраспределители»
13, г.
30
. Количество патогенов в кашле может быть критическим показателем передачи инфекционных заболеваний, борьбы с эпидемиями и мониторинга колонизации.В Джонс-Лопес
и др. . исследование, количество аэрозольных
M.tuberculosis резко снизилась после трех недель лечения. Таким образом, образец кашля также можно использовать для мониторинга уровня резистентных бактерий, если они присутствуют.

В опубликованных руководствах для пациентов с муковисцидозом предлагается ежеквартально собирать образцы из дыхательных путей для мониторинга легочных инфекций
26, г.
27
. Образцы кашля могут быть более специфичным и чувствительным методом мониторинга колонизации и определения инфекционности.Дополнительные исследования могут дополнительно изучить это приложение путем сравнения
С
T
значений с симптомами. Если за пациентом с муковисцидозом регулярно наблюдают, используя образцы от кашля, внезапное снижение
С
T Значение
может указывать на изменение бремени патогенов
32, г.
33
. То
С
T
Величина содержания патогенов в аэрозолях от кашля может быть полезной в качестве меры для определения того, растет ли количество возбудителей в легких.

Это исследование имеет несколько ограничений.В наше исследование были включены только взрослые пациенты; таким образом, мы не можем комментировать образование аэрозоля при кашле у детей. В этом исследовании сообщается о 20 пациентах. В большинстве исследований, опубликованных в литературе, задействовано одинаковое количество субъектов, поскольку идентификация нижних дыхательных путей всегда была огромной проблемой.
12, г.
13
. Будущие исследования могут оценить преимущества необходимости большего количества кашля или кашля в течение определенного периода времени, например 5 минут, для установления
С
T
пороговые значения для этого нового метода сбора образцов.Молекулярные анализы RT-PCR, использованные в этом исследовании, доступны не во всех больницах, хотя несколько коммерческих лабораторий могут предоставлять услуги по клинической респираторной идентификации.

Заключение

Таким образом, мы показали, что новое устройство может собирать легочные патогены взрослых пациентов с муковисцидозом из аэрозолей от кашля с идентификацией с помощью молекулярного анализа. Устройство исключает загрязнения полости рта, показывая более высокую специфичность, чем образцы мокроты. Выявление возбудителей в нижних дыхательных путях, вероятно, сыграет важную роль в лечении пациентов.
24 .Данные этого исследования предлагают альтернативу сбору мокроты для идентификации возбудителей нижних дыхательных путей.

Согласие

Письменное информированное согласие было получено всеми участниками в соответствии с протоколом Институционального наблюдательного совета № 000-2492, утвержденным Технологическим институтом Джорджии, Университетом Эмори и Центрами США по контролю и профилактике заболеваний.

Доступность данных

Данные, на которые ссылается эта статья, защищены авторским правом со следующим заявлением об авторских правах: Авторское право: © 2016 Ku DN et al.

Все необработанные данные представлены в таблицах выше.

Примечания

[версия 1; рефери: одобрено 2]

Заявление о финансировании

При поддержке внутренних грантов Центров США по контролю и профилактике заболеваний и Университетской больницы Эмори.

Спонсоры не участвовали в разработке дизайна исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Каталожные номера

1.
Бернс МВт:
Преципитины к клебсиеллам и другим энтеробактериям в сыворотке крови больных хроническими респираторными заболеваниями. Ланцет.
1968; 1 (7539): 383–385.
10.1016/С0140-6736(68)-6
[PubMed] [CrossRef] [Google Scholar]2.
Годдард А.Ф., Штаудингер Б.Дж., Дауд С.Е. и др. :
Прямые пробы легких при муковисцидозе указывают на то, что анализы образцов верхних дыхательных путей на основе ДНК могут искажать микробиоту легких.
Proc Natl Acad Sci U S A.
2012;109(34):13769–13774.
10.1073/пнас.1107435109

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]3.
Лентино-младший, Лакс Д.А.:
Неценность посева мокроты при лечении инфекций нижних дыхательных путей. J Clin Microbiol.
1987; 25(5):758–762.

[Бесплатная статья PMC] [PubMed] [Google Scholar]4.
Розенфельд М., Эмерсон Дж., Аккурсо Ф. и др. :
Диагностическая точность культур из ротоглотки у младенцев и детей раннего возраста с муковисцидозом.
Педиатр Пульмонол.
1999;28(5):321–328.
10.1002/(SICI)1099-0496(199911)28:5<321::AID-PPUL3>3.0.CO;2-V
[PubMed] [CrossRef] [Google Scholar]5.
Гилкрист Ф.Дж., Саламат С., Клейтон С. и др. :
Бронхоальвеолярный лаваж у детей с муковисцидозом: сколько долей следует брать?
Арч Ди Чайлд.
2011;96:215–217.
10.1136/доп.2009.177618
[PubMed] [CrossRef] [Google Scholar]6.
Уилнер Д., Хейнс М.Р., Фурлан М. и др. :
Пространственное распределение микробных сообществ в легком при муковисцидозе.
ИСМЕ Дж.
2012;6(2):471–474.
10.1038/исмей.2011.104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]7.
Уимберли Н., Фалинг Л.Дж., Бартлетт Дж.Г.:
Метод фиброоптической бронхоскопии для получения незагрязненных выделений из нижних дыхательных путей для бактериального посева.
Am Rev Respir Dis.
1979;119(3):337–343.
[PubMed] [Google Scholar]8.
Коуч Р.Б., Кейт Т.Р., Дуглас Р.Г.-младший и др. :
Влияние пути прививки на экспериментальное респираторное вирусное заболевание у добровольцев и доказательства воздушно-капельной передачи.
Бактериол Ред.
1966; 30 (3): 517–529.

[Бесплатная статья PMC] [PubMed] [Google Scholar]9.
Коуч Р.Б., Кейт Т.Р., Героне П.Дж. и др. :
Появление болезни с помощью мелкодисперсного аэрозоля Коксаки А
21 .
Дж Клин Инвест.
1965; 44 (4): 535–542.10.1172/ДЖКИ105166

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10.
Gerone PJ, Couch RB, Keefer GV и др. :
Оценка экспериментальных и природных вирусных аэрозолей.
Бактериол Ред.
1966; 30 (3): 576–584.

[Бесплатная статья PMC] [PubMed] [Google Scholar]11.
Ли Н., Чан П.К., Хуэй Д.С. и др. :
Вирусная нагрузка и продолжительность выделения вируса у взрослых пациентов, госпитализированных с гриппом.
J Заразить Dis.
2009;200(4):492–500.
10.1086/600383
[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]12.Уэйнрайт К.Э., Франция М.В., О’Рурк П. и др. :
Аэрозоли, вызываемые кашлем
Pseudomonas aeruginosa и другие грамотрицательные бактерии от пациентов с муковисцидозом.
Грудная клетка.
2009;64(11):926–931.
10.1136/thx.2008.112466

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13.
Ниббс Л.Д., Джонсон Г.Р., Кидд Т.Дж. и др. :
Жизнеспособность
Pseudomonas aeruginosa в аэрозолях от кашля, выделяемых людьми с муковисцидозом.
Грудная клетка.
2014;69(8):740–745.10.1136/thoraxjnl-2014-205213

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]14.
Лильемарк В.Ф., Гиббонс Р.Дж.:
Пропорциональное распределение и относительная адгезия стрептококковых клещей (
mitis ) на различных поверхностях ротовой полости человека.
Заразить иммунн.
1972; 6 (5): 852–859.

[Бесплатная статья PMC] [PubMed] [Google Scholar]15.
Hart MC, Orzalesi MM, Cook CD:
Связь между анатомическим мертвым пространством дыхательных путей, размерами тела и объемом легких.
J Appl Physiol.
1963; 18 (3): 519–522.Справочный источник
[Google Академия] 16.
Scholz TL, Midha PA, Anderson LJ, et al. :
PneumoniaCheck: устройство для отбора проб аэрозолей из нижних дыхательных путей.
J Med Devices.
2010;4(4):041005
10.1115/1.4002760
[Перекрестная ссылка] [Академия Google] 17.
Реестр пациентов Фонда кистозного фиброза: Ежегодный отчет о данных за 2013 г. для директоров Центра. Бетесда, Мэриленд. 2014 г. [Google Академия] 18.
Фернесс Дж. К., Хабеб А., Спенсер Д. А. и соавт. :
В редакцию: Бронхоальвеолярный лаваж (БАЛ) при педиатрическом муковисцидозе (МВ): его клиническое применение, модифицированное аудитом в региональном центре МВ. Педиатр Пульмонол.
2002;33(3):234.
10.1002/стр.10052
[PubMed] [CrossRef] [Google Scholar] 20.
Рэмси Б.В., Венц К.Р., Смит А.Л. и соавт. :
Прогностическая ценность культур ротоглотки для выявления бактерий нижних дыхательных путей у пациентов с муковисцидозом.
Am Rev Respir Dis.
1991;144(2):331–337.
10.1164/ajrccm/144.2.331
[PubMed] [CrossRef] [Google Scholar] 21.
Армстронг Д.С., Гримвуд К., Карлин Дж.Б. и др. :
Бронхоальвеолярный лаваж или посев из ротоглотки для выявления патогенов нижних дыхательных путей у младенцев с муковисцидозом. Педиатр Пульмонол.
1996;21(5):267–275.
10.1002/(SICI)1099-0496(199605)21:5<267::AID-PPUL1>3.0.CO;2-K
[PubMed] [CrossRef] [Google Scholar] 22.
Harris JK, De Groote MA, Sagel SD, et al. :
Молекулярная идентификация бактерий в жидкости бронхоальвеолярного лаважа у детей с муковисцидозом.
Proc Natl Acad Sci U S A.
2007;104(51):20529–20533.
10.1073/пнас.0709804104

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]23.
Zemanick ET, Wagner BD, Harris JK, et al.:
Легочные обострения при муковисцидозе с отрицательными бактериальными культурами.
Педиатр Пульмонол.
2010;45(6):569–577.
10.1002/стр.21221

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]24.
Oosterheert JJ, Bonten MJ, Buskens E, et al. :
Алгоритм определения экономии затрат на таргетную антимикробную терапию по результатам экспресс-диагностики.
J Clin Microbiol.
2003;41(10):4708–4713.
10.1128/JCM.41.10.4708-4713.2003

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25.Эмери С.Л., Эрдман Д.Д., Боуэн М.Д. и соавт. :
Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для коронавируса, связанного с SARS.
Emer Infect Dis.
2004;10(2):311–316.
10.3201/eid1002.030759

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]26.
Сайман Л., Сигел Дж.,
Фонд муковисцидоза:
Рекомендации по инфекционному контролю для пациентов с муковисцидозом: микробиология, важные патогены и методы инфекционного контроля для предотвращения передачи инфекции от пациента к пациенту. Infect Control Hosp Epidemiol.
2003; 24 (5 Дополнение): S6–52.
10.1086/503485
[PubMed] [CrossRef] [Google Scholar] 27.
Yankaskas JR, Marshall BC, Sufian B, et al. :
Уход за взрослыми при муковисцидозе: консенсусный отчет конференции.
Сундук.
2004; 125 (1 Приложение): 1С–39С.
10.1378/грудь.125.1_доп.1С
[PubMed] [CrossRef] [Google Scholar] 28.
Сойер О.У., Диздар Э.А., Кескин О. и соавт. :
Сравнение двух методов сбора конденсата выдыхаемого воздуха.
Аллергия.
2006;61(8):1016–1018.
10.1111/j.1398-9995.2006.01064.x
[PubMed] [CrossRef] [Google Scholar] 29.
Феннелли К.П., Мартини Дж.В., Фултон К.Е. и др. :
Аэрозоли, вызываемые кашлем
Mycobacterium tuberculosis : новый метод изучения инфекционности.
Am J Respir Crit Care Med.
2004;169(5):604–609.
10.1164/rccm.200308-1101OC
[PubMed] [CrossRef] [Google Scholar] 30.
Феннелли К.П., Джонс-Лопес Э.К., Аякака И. и др. :
Изменчивость инфекционных аэрозолей, образующихся при кашле у больных туберкулезом легких. Am J Respir Crit Care Med.
2012;186(5):450–457.
10.1164/rccm.201203-0444OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]31.
Джонс-Лопес Э.К., Намугга О., Мамбова Ф. и др. :
аэрозоли от кашля
Mycobacterium tuberculosis предсказывают новую инфекцию: исследование бытовых контактов.
Am J Respir Crit Care Med.
2013;187(9):1007–1015.
10.1164/rccm.201208-1422OC

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]32.
Мехта Т., МакГрат Э., Бхимредди С. и др.:
Обнаружение устойчивости к осельтамивиру во время лечения инфекции вируса гриппа h2N1 2009 у пациентов с ослабленным иммунитетом: полезность пороговых значений цикла качественной ПЦР с обратной транскриптазой в реальном времени.
J Clin Microbiol.
2010;48(11):4326–4328.
10.1128/JCM.01190-10

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]33.
Эспи М.Дж., Уль Дж.Р., Слоан Л.М. и др. :
ПЦР в реальном времени в клинической микробиологии: приложения для рутинных лабораторных испытаний.
Clin Microbiol, версия
2006;19(1):165–256.10.1128/CMR.19.1.165-256.2006

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]34.
Xu Z, Shen F, Li X и др. :
Молекулярный и микроскопический анализ бактерий и вирусов в выдыхаемом воздухе, собранном с помощью простого метода импакции и конденсации.
PLoS Один.
2012;7(7):e41137.
10.1371/journal.pone.0041137

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]35.
Хауспи Л., Де Костер С., Кейартс Э. и др. :
Отбор проб конденсата выдыхаемого воздуха не является новым методом обнаружения респираторных вирусов. Вирол Дж.
2011;8:98.
10.1186/1743-422Х-8-98

[Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]36.

Добавить комментарий

Ваш адрес email не будет опубликован.